Incidental Mutation 'R4630:Brpf1'
ID349109
Institutional Source Beutler Lab
Gene Symbol Brpf1
Ensembl Gene ENSMUSG00000001632
Gene Namebromodomain and PHD finger containing, 1
Synonyms4930540D11Rik, 4833438B11Rik
MMRRC Submission 041895-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4630 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113307137-113324860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113309906 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 32 (Y32H)
Ref Sequence ENSEMBL: ENSMUSP00000145093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041203] [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626]
Predicted Effect probably benign
Transcript: ENSMUST00000041203
SMART Domains Protein: ENSMUSP00000044416
Gene: ENSMUSG00000030270

DomainStartEndE-ValueType
C2 14 122 2.12e-10 SMART
C2 143 257 5.15e-9 SMART
VWA 297 495 4.4e-10 SMART
low complexity region 536 553 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113117
AA Change: Y32H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632
AA Change: Y32H

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113119
AA Change: Y32H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632
AA Change: Y32H

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113121
AA Change: Y32H

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632
AA Change: Y32H

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113122
AA Change: Y32H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632
AA Change: Y32H

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203569
Predicted Effect probably damaging
Transcript: ENSMUST00000203577
AA Change: Y32H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632
AA Change: Y32H

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204198
AA Change: Y32H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632
AA Change: Y32H

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204626
AA Change: Y32H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632
AA Change: Y32H

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain, PHD finger and chromo/Tudor-related Pro-Trp-Trp-Pro (PWWP) domain containing protein. The encoded protein is a component of the MOZ/MORF histone acetyltransferase complexes which function as a transcriptional regulators. This protein binds to the catalytic MYST domains of the MOZ and MORF proteins and may play a role in stimulating acetyltransferase and transcriptional activity of the complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality around E9.5 and disrupts histone acetylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
3110001I22Rik T C 16: 13,677,414 S126P probably damaging Het
3110070M22Rik A T 13: 119,488,086 probably benign Het
4833423E24Rik C A 2: 85,518,646 G41* probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC024139 T G 15: 76,125,094 Q240P probably benign Het
Bckdha A T 7: 25,631,459 I44N probably damaging Het
Catip A G 1: 74,368,913 probably benign Het
Ccdc138 T C 10: 58,573,655 L602P probably damaging Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Comp A T 8: 70,374,382 I58F possibly damaging Het
Crygs T C 16: 22,805,518 E113G possibly damaging Het
Dnmt3b C T 2: 153,670,315 R319* probably null Het
Eif3a A G 19: 60,769,928 I804T unknown Het
Eif3a A T 19: 60,777,986 H301Q probably benign Het
Elf3 A T 1: 135,256,740 probably benign Het
Gm10384 A G 15: 36,871,773 noncoding transcript Het
Gm11627 T A 11: 102,578,831 probably benign Het
Gpr183 A T 14: 121,954,849 Y87N probably damaging Het
Gpr183 G C 14: 121,954,850 Y86* probably null Het
Gpr26 T C 7: 131,966,980 V18A probably damaging Het
Herc1 T A 9: 66,433,714 probably null Het
Hint2 C T 4: 43,656,396 probably benign Het
Jag1 A T 2: 137,085,979 D837E probably damaging Het
Jmjd1c C A 10: 67,157,974 S78* probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lama1 T A 17: 67,794,300 D1929E probably benign Het
Macf1 T C 4: 123,473,639 K878R possibly damaging Het
Mboat4 T C 8: 34,123,954 S182P probably damaging Het
Muc5b A T 7: 141,857,984 T1556S unknown Het
Myo1g T C 11: 6,519,047 Y85C probably damaging Het
Ncapd2 C A 6: 125,179,233 probably null Het
Nox3 T C 17: 3,693,982 D96G possibly damaging Het
Olfr23 T C 11: 73,940,996 L250P probably damaging Het
Olfr514 T C 7: 108,825,595 M135V probably damaging Het
Olfr805 A G 10: 129,723,481 L21P probably damaging Het
Pacs1 C T 19: 5,156,356 probably null Het
Pgm5 C A 19: 24,834,746 G141* probably null Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pld4 T A 12: 112,765,064 V217D probably damaging Het
Ppp1r3c T C 19: 36,733,515 E285G probably benign Het
Pradc1 T A 6: 85,447,293 M24L possibly damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Rtkn A T 6: 83,152,182 K540* probably null Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Setd4 A G 16: 93,591,226 L124P probably benign Het
Sh3gl2 A G 4: 85,379,409 D208G probably damaging Het
Sult4a1 T C 15: 84,105,578 T8A possibly damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Tlr4 A G 4: 66,839,240 E90G probably benign Het
Tmem123 T C 9: 7,791,392 L164P probably damaging Het
Tmem246 C G 4: 49,586,254 V305L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trp53bp1 G T 2: 121,207,887 A1490D probably damaging Het
Ttc16 T C 2: 32,775,377 probably benign Het
Tyw5 T A 1: 57,388,527 Q306L probably damaging Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zar1 A G 5: 72,580,906 V51A probably benign Het
Zbtb38 T G 9: 96,688,851 N60T probably damaging Het
Zfp354a T C 11: 51,070,218 S417P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp518a C T 19: 40,912,979 Q451* probably null Het
Zfp64 T C 2: 168,926,543 N383S possibly damaging Het
Zfp687 A T 3: 95,012,488 probably null Het
Other mutations in Brpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Brpf1 APN 6 113316684 missense probably damaging 0.99
IGL00697:Brpf1 APN 6 113314986 missense probably damaging 1.00
IGL00823:Brpf1 APN 6 113321886 missense probably benign 0.01
IGL00951:Brpf1 APN 6 113322553 missense probably damaging 1.00
IGL01335:Brpf1 APN 6 113319337 missense probably damaging 0.99
IGL01565:Brpf1 APN 6 113316650 missense probably damaging 1.00
IGL02237:Brpf1 APN 6 113310375 missense probably damaging 1.00
R1484:Brpf1 UTSW 6 113315135 missense probably damaging 1.00
R1502:Brpf1 UTSW 6 113322420 missense probably damaging 1.00
R1517:Brpf1 UTSW 6 113319089 missense probably benign 0.17
R1525:Brpf1 UTSW 6 113317154 missense probably damaging 1.00
R1773:Brpf1 UTSW 6 113319931 missense possibly damaging 0.85
R1925:Brpf1 UTSW 6 113319930 missense probably damaging 0.96
R2928:Brpf1 UTSW 6 113322046 missense possibly damaging 0.95
R3900:Brpf1 UTSW 6 113318433 missense probably benign 0.20
R4019:Brpf1 UTSW 6 113310282 missense probably damaging 0.97
R4754:Brpf1 UTSW 6 113320447 missense possibly damaging 0.92
R4757:Brpf1 UTSW 6 113315111 missense probably damaging 1.00
R4858:Brpf1 UTSW 6 113317678 missense possibly damaging 0.56
R4866:Brpf1 UTSW 6 113322470 missense probably damaging 0.97
R5073:Brpf1 UTSW 6 113310254 missense probably damaging 0.97
R5197:Brpf1 UTSW 6 113319941 missense possibly damaging 0.57
R7011:Brpf1 UTSW 6 113318466 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGAATCTACTGTATGGTGTGGG -3'
(R):5'- GATGCTGATTCGGTGGACAC -3'

Sequencing Primer
(F):5'- GAGCTGGAAACTGTCAGGCC -3'
(R):5'- AAGGTCCACTTCTACCATGCG -3'
Posted On2015-10-08