Incidental Mutation 'R4630:Olfr805'
ID349128
Institutional Source Beutler Lab
Gene Symbol Olfr805
Ensembl Gene ENSMUSG00000096858
Gene Nameolfactory receptor 805
SynonymsGA_x6K02T2PULF-11402237-11401278, MOR110-4
MMRRC Submission 041895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4630 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129721221-129729375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129723481 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 21 (L21P)
Ref Sequence ENSEMBL: ENSMUSP00000149493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078876] [ENSMUST00000204717] [ENSMUST00000216794] [ENSMUST00000217219]
Predicted Effect probably damaging
Transcript: ENSMUST00000078876
AA Change: L21P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092874
Gene: ENSMUSG00000096858
AA Change: L21P

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.9e-52 PFAM
Pfam:7tm_1 39 288 5.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203573
AA Change: L21P
SMART Domains Protein: ENSMUSP00000144843
Gene: ENSMUSG00000096858
AA Change: L21P

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.9e-52 PFAM
Pfam:7tm_1 39 288 5.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204717
AA Change: L21P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216794
AA Change: L21P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217219
AA Change: L21P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
3110001I22Rik T C 16: 13,677,414 S126P probably damaging Het
3110070M22Rik A T 13: 119,488,086 probably benign Het
4833423E24Rik C A 2: 85,518,646 G41* probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC024139 T G 15: 76,125,094 Q240P probably benign Het
Bckdha A T 7: 25,631,459 I44N probably damaging Het
Brpf1 T C 6: 113,309,906 Y32H probably damaging Het
Catip A G 1: 74,368,913 probably benign Het
Ccdc138 T C 10: 58,573,655 L602P probably damaging Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Comp A T 8: 70,374,382 I58F possibly damaging Het
Crygs T C 16: 22,805,518 E113G possibly damaging Het
Dnmt3b C T 2: 153,670,315 R319* probably null Het
Eif3a A G 19: 60,769,928 I804T unknown Het
Eif3a A T 19: 60,777,986 H301Q probably benign Het
Elf3 A T 1: 135,256,740 probably benign Het
Gm10384 A G 15: 36,871,773 noncoding transcript Het
Gm11627 T A 11: 102,578,831 probably benign Het
Gpr183 A T 14: 121,954,849 Y87N probably damaging Het
Gpr183 G C 14: 121,954,850 Y86* probably null Het
Gpr26 T C 7: 131,966,980 V18A probably damaging Het
Herc1 T A 9: 66,433,714 probably null Het
Hint2 C T 4: 43,656,396 probably benign Het
Jag1 A T 2: 137,085,979 D837E probably damaging Het
Jmjd1c C A 10: 67,157,974 S78* probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lama1 T A 17: 67,794,300 D1929E probably benign Het
Macf1 T C 4: 123,473,639 K878R possibly damaging Het
Mboat4 T C 8: 34,123,954 S182P probably damaging Het
Muc5b A T 7: 141,857,984 T1556S unknown Het
Myo1g T C 11: 6,519,047 Y85C probably damaging Het
Ncapd2 C A 6: 125,179,233 probably null Het
Nox3 T C 17: 3,693,982 D96G possibly damaging Het
Olfr23 T C 11: 73,940,996 L250P probably damaging Het
Olfr514 T C 7: 108,825,595 M135V probably damaging Het
Pacs1 C T 19: 5,156,356 probably null Het
Pgm5 C A 19: 24,834,746 G141* probably null Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pld4 T A 12: 112,765,064 V217D probably damaging Het
Ppp1r3c T C 19: 36,733,515 E285G probably benign Het
Pradc1 T A 6: 85,447,293 M24L possibly damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Rtkn A T 6: 83,152,182 K540* probably null Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Setd4 A G 16: 93,591,226 L124P probably benign Het
Sh3gl2 A G 4: 85,379,409 D208G probably damaging Het
Sult4a1 T C 15: 84,105,578 T8A possibly damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Tlr4 A G 4: 66,839,240 E90G probably benign Het
Tmem123 T C 9: 7,791,392 L164P probably damaging Het
Tmem246 C G 4: 49,586,254 V305L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trp53bp1 G T 2: 121,207,887 A1490D probably damaging Het
Ttc16 T C 2: 32,775,377 probably benign Het
Tyw5 T A 1: 57,388,527 Q306L probably damaging Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zar1 A G 5: 72,580,906 V51A probably benign Het
Zbtb38 T G 9: 96,688,851 N60T probably damaging Het
Zfp354a T C 11: 51,070,218 S417P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp518a C T 19: 40,912,979 Q451* probably null Het
Zfp64 T C 2: 168,926,543 N383S possibly damaging Het
Zfp687 A T 3: 95,012,488 probably null Het
Other mutations in Olfr805
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Olfr805 APN 10 129722945 missense probably benign
IGL01341:Olfr805 APN 10 129722878 missense possibly damaging 0.87
IGL01960:Olfr805 APN 10 129722887 missense probably damaging 1.00
IGL02729:Olfr805 APN 10 129723521 missense probably benign 0.01
IGL02969:Olfr805 APN 10 129723196 missense probably damaging 0.99
R0116:Olfr805 UTSW 10 129722977 missense probably damaging 1.00
R1236:Olfr805 UTSW 10 129722806 missense probably damaging 0.98
R1332:Olfr805 UTSW 10 129723247 missense probably damaging 1.00
R2428:Olfr805 UTSW 10 129722783 missense probably benign 0.05
R3725:Olfr805 UTSW 10 129723115 missense probably damaging 1.00
R3726:Olfr805 UTSW 10 129723115 missense probably damaging 1.00
R3804:Olfr805 UTSW 10 129723049 missense possibly damaging 0.93
R4365:Olfr805 UTSW 10 129723412 missense probably damaging 0.99
R4735:Olfr805 UTSW 10 129722923 missense probably benign 0.06
R4923:Olfr805 UTSW 10 129722812 missense probably benign 0.03
R4962:Olfr805 UTSW 10 129722723 missense probably damaging 1.00
R5324:Olfr805 UTSW 10 129722945 missense probably benign
R5406:Olfr805 UTSW 10 129722930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATCAAGAATCGTGGAATGC -3'
(R):5'- GAGGACAAGATTGTGAGTAAACTCT -3'

Sequencing Primer
(F):5'- GCAAGAAGATGTGAATGCCATTTCC -3'
(R):5'- TGAAGAACCAGTCAGTAGA -3'
Posted On2015-10-08