Incidental Mutation 'R4631:Vmn1r73'
ID349188
Institutional Source Beutler Lab
Gene Symbol Vmn1r73
Ensembl Gene ENSMUSG00000051687
Gene Namevomeronasal 1 receptor 73
SynonymsV1rg2
MMRRC Submission 041896-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4631 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location11730266-11762081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11756831 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 192 (C192Y)
Ref Sequence ENSEMBL: ENSMUSP00000153827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055070] [ENSMUST00000226516]
Predicted Effect probably benign
Transcript: ENSMUST00000055070
AA Change: C192Y

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055353
Gene: ENSMUSG00000051687
AA Change: C192Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 7.5e-7 PFAM
Pfam:V1R 32 297 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226516
AA Change: C192Y

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,257,987 L368Q probably damaging Het
Abcc2 C T 19: 43,814,707 P661S possibly damaging Het
Adgre4 T G 17: 55,814,305 M457R probably null Het
Ank C A 15: 27,467,090 F29L probably benign Het
Arhgap20 T C 9: 51,840,353 probably benign Het
Atf6 T C 1: 170,747,197 probably null Het
Bod1l A G 5: 41,817,735 F2079L probably damaging Het
Cd163 T C 6: 124,329,086 *1122Q probably null Het
Ces2g T C 8: 104,967,462 probably null Het
Cntnap3 A G 13: 64,778,883 Y558H probably benign Het
Ctsm T A 13: 61,537,696 S301C probably null Het
Dlc1 A C 8: 36,937,558 probably null Het
Dlg2 A T 7: 92,088,614 I435F probably damaging Het
Dnah5 T C 15: 28,401,953 V3420A probably damaging Het
Dnah5 T A 15: 28,419,994 Y3813N probably damaging Het
Dnajc13 A G 9: 104,190,417 M1181T probably damaging Het
Drc3 C A 11: 60,364,908 T107N probably benign Het
Dydc2 T C 14: 41,049,329 E131G probably benign Het
Eif5b T C 1: 38,041,747 V723A probably damaging Het
Fndc9 C A 11: 46,237,848 H65N possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Gm1966 A G 7: 106,599,523 noncoding transcript Het
Gm38394 A T 1: 133,658,744 V285E probably damaging Het
Gm5096 G A 18: 87,756,401 R16H probably damaging Het
Gps1 T A 11: 120,788,239 probably null Het
Kazn G A 4: 142,118,160 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnip1 T A 11: 33,992,821 noncoding transcript Het
Kif19a A G 11: 114,784,847 I382V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Malsu1 A T 6: 49,084,533 E177V probably damaging Het
Man2a2 A G 7: 80,362,463 F649L probably benign Het
Map3k11 A G 19: 5,690,913 I223V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh9 T G 15: 77,797,028 D164A probably damaging Het
Myo16 T C 8: 10,506,984 I1040T probably damaging Het
Myo18b C T 5: 112,846,400 A896T probably damaging Het
Myocd G T 11: 65,178,859 N798K probably benign Het
Olfr1206 C T 2: 88,864,830 T75I probably benign Het
Olfr1288 T A 2: 111,479,563 W260R probably damaging Het
Olfr1458 T A 19: 13,103,272 I11F probably benign Het
Olfr156 T C 4: 43,820,563 D266G probably benign Het
Olfr168 G A 16: 19,530,141 R260* probably null Het
Olfr353 T G 2: 36,890,618 T77P probably benign Het
Olfr68 A T 7: 103,777,475 L290Q probably damaging Het
Pcdh18 T A 3: 49,756,441 I142F probably damaging Het
Pcyox1 T C 6: 86,389,143 D363G probably benign Het
Pcyox1 T C 6: 86,389,230 E334G possibly damaging Het
Pgm1 A G 5: 64,105,947 probably null Het
Plagl1 T G 10: 13,127,999 probably benign Het
Ppp1r9a A G 6: 4,906,537 D364G possibly damaging Het
Rab2b T A 14: 52,266,242 H141L possibly damaging Het
Rev3l A G 10: 39,828,416 K279E probably benign Het
Rnf111 G T 9: 70,450,396 T607N probably benign Het
Scn8a C A 15: 101,016,503 S1130* probably null Het
Selenbp1 A G 3: 94,944,568 *473W probably null Het
Sh3bp4 A C 1: 89,144,273 D281A probably damaging Het
Skint5 T A 4: 113,629,117 probably null Het
Slc1a4 A G 11: 20,308,452 L249P probably damaging Het
Slc45a2 T A 15: 11,012,576 S222T probably benign Het
Slc7a4 A G 16: 17,574,391 F393S probably damaging Het
Slc9a2 A T 1: 40,761,918 D536V possibly damaging Het
Stra6 T A 9: 58,140,832 probably benign Het
Tmem145 A G 7: 25,307,825 D156G probably benign Het
Tns3 A C 11: 8,451,119 F1060V probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trappc8 A G 18: 20,867,808 S273P probably benign Het
Trmt11 A G 10: 30,559,204 S320P probably benign Het
Ugt1a6a A T 1: 88,139,258 Y262F probably benign Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Vmn2r25 T A 6: 123,853,003 D63V possibly damaging Het
Vps13b C T 15: 35,646,132 H1461Y possibly damaging Het
Ythdc2 A T 18: 44,887,631 E1427D probably benign Het
Zbtb26 A G 2: 37,436,956 F23L probably benign Het
Zfp62 T A 11: 49,217,805 *908R probably null Het
Zfp975 A T 7: 42,662,945 N81K probably benign Het
Zkscan16 G A 4: 58,951,918 V198M probably damaging Het
Other mutations in Vmn1r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Vmn1r73 APN 7 11756738 missense probably benign 0.02
IGL02337:Vmn1r73 APN 7 11756713 missense possibly damaging 0.69
IGL02666:Vmn1r73 APN 7 11756938 missense probably damaging 1.00
IGL02741:Vmn1r73 APN 7 11756783 missense probably benign 0.05
IGL02756:Vmn1r73 APN 7 11756647 missense possibly damaging 0.95
IGL03113:Vmn1r73 APN 7 11756600 missense probably benign
IGL03195:Vmn1r73 APN 7 11757080 missense probably damaging 1.00
R0023:Vmn1r73 UTSW 7 11757070 missense probably benign 0.43
R0379:Vmn1r73 UTSW 7 11756846 missense probably benign 0.16
R3941:Vmn1r73 UTSW 7 11756755 missense probably damaging 1.00
R4224:Vmn1r73 UTSW 7 11756579 missense probably damaging 0.99
R4912:Vmn1r73 UTSW 7 11756669 missense probably damaging 0.99
R5060:Vmn1r73 UTSW 7 11756756 missense probably damaging 1.00
R5450:Vmn1r73 UTSW 7 11756449 missense possibly damaging 0.63
R5609:Vmn1r73 UTSW 7 11756664 nonsense probably null
R6059:Vmn1r73 UTSW 7 11756611 missense probably benign 0.40
R6508:Vmn1r73 UTSW 7 11756704 missense possibly damaging 0.73
R6967:Vmn1r73 UTSW 7 11756617 nonsense probably null
R7099:Vmn1r73 UTSW 7 11756393 missense probably damaging 1.00
R7304:Vmn1r73 UTSW 7 11756897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACATTGGTCCCTCCTGC -3'
(R):5'- TACACTTACTCGCAGTAACATTGG -3'

Sequencing Primer
(F):5'- TCCTGCTCAGTGGGCTG -3'
(R):5'- CTCGCAGTAACATTGGATATTTGAAG -3'
Posted On2015-10-08