Incidental Mutation 'R4631:Dlg2'
ID349191
Institutional Source Beutler Lab
Gene Symbol Dlg2
Ensembl Gene ENSMUSG00000052572
Gene Namediscs large MAGUK scaffold protein 2
SynonymsDlgh2, A330103J02Rik, Chapsyn-110, PSD93, B330007M19Rik, LOC382816, B230218P12Rik
MMRRC Submission 041896-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4631 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location90476672-92449247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92088614 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 435 (I435F)
Ref Sequence ENSEMBL: ENSMUSP00000102814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074273] [ENSMUST00000098308] [ENSMUST00000107193] [ENSMUST00000107196] [ENSMUST00000231777]
PDB Structure
CRYSTAL STRUCTURE OF THE PSD93 PDZ1 DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000074273
AA Change: I435F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073885
Gene: ENSMUSG00000052572
AA Change: I435F

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
low complexity region 631 644 N/A INTRINSIC
GuKc 679 858 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098308
AA Change: I32F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095910
Gene: ENSMUSG00000052572
AA Change: I32F

DomainStartEndE-ValueType
PDZ 26 99 1.77e-24 SMART
low complexity region 120 127 N/A INTRINSIC
SH3 136 202 7.82e-10 SMART
low complexity region 228 241 N/A INTRINSIC
GuKc 290 469 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107193
AA Change: I338F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102811
Gene: ENSMUSG00000052572
AA Change: I338F

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
PDZ 61 140 1.15e-23 SMART
PDZ 156 235 9.86e-23 SMART
PDZ 332 405 1.77e-24 SMART
low complexity region 426 433 N/A INTRINSIC
SH3 442 508 7.82e-10 SMART
GuKc 564 743 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107196
AA Change: I435F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102814
Gene: ENSMUSG00000052572
AA Change: I435F

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
GuKc 661 840 2.6e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207593
Predicted Effect probably damaging
Transcript: ENSMUST00000231777
AA Change: I540F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower surface expression of NMDA receptor (NMDAR) subunits NR2A and NR2B in dorsal horn neurons and significantly reduced NMDAR-mediated excitatory synaptic currents and NMDAR-dependent persistent inflammatory or nerve injury-induced neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,257,987 L368Q probably damaging Het
Abcc2 C T 19: 43,814,707 P661S possibly damaging Het
Adgre4 T G 17: 55,814,305 M457R probably null Het
Ank C A 15: 27,467,090 F29L probably benign Het
Arhgap20 T C 9: 51,840,353 probably benign Het
Atf6 T C 1: 170,747,197 probably null Het
Bod1l A G 5: 41,817,735 F2079L probably damaging Het
Cd163 T C 6: 124,329,086 *1122Q probably null Het
Ces2g T C 8: 104,967,462 probably null Het
Cntnap3 A G 13: 64,778,883 Y558H probably benign Het
Ctsm T A 13: 61,537,696 S301C probably null Het
Dlc1 A C 8: 36,937,558 probably null Het
Dnah5 T C 15: 28,401,953 V3420A probably damaging Het
Dnah5 T A 15: 28,419,994 Y3813N probably damaging Het
Dnajc13 A G 9: 104,190,417 M1181T probably damaging Het
Drc3 C A 11: 60,364,908 T107N probably benign Het
Dydc2 T C 14: 41,049,329 E131G probably benign Het
Eif5b T C 1: 38,041,747 V723A probably damaging Het
Fndc9 C A 11: 46,237,848 H65N possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Gm1966 A G 7: 106,599,523 noncoding transcript Het
Gm38394 A T 1: 133,658,744 V285E probably damaging Het
Gm5096 G A 18: 87,756,401 R16H probably damaging Het
Gps1 T A 11: 120,788,239 probably null Het
Kazn G A 4: 142,118,160 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnip1 T A 11: 33,992,821 noncoding transcript Het
Kif19a A G 11: 114,784,847 I382V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Malsu1 A T 6: 49,084,533 E177V probably damaging Het
Man2a2 A G 7: 80,362,463 F649L probably benign Het
Map3k11 A G 19: 5,690,913 I223V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh9 T G 15: 77,797,028 D164A probably damaging Het
Myo16 T C 8: 10,506,984 I1040T probably damaging Het
Myo18b C T 5: 112,846,400 A896T probably damaging Het
Myocd G T 11: 65,178,859 N798K probably benign Het
Olfr1206 C T 2: 88,864,830 T75I probably benign Het
Olfr1288 T A 2: 111,479,563 W260R probably damaging Het
Olfr1458 T A 19: 13,103,272 I11F probably benign Het
Olfr156 T C 4: 43,820,563 D266G probably benign Het
Olfr168 G A 16: 19,530,141 R260* probably null Het
Olfr353 T G 2: 36,890,618 T77P probably benign Het
Olfr68 A T 7: 103,777,475 L290Q probably damaging Het
Pcdh18 T A 3: 49,756,441 I142F probably damaging Het
Pcyox1 T C 6: 86,389,143 D363G probably benign Het
Pcyox1 T C 6: 86,389,230 E334G possibly damaging Het
Pgm1 A G 5: 64,105,947 probably null Het
Plagl1 T G 10: 13,127,999 probably benign Het
Ppp1r9a A G 6: 4,906,537 D364G possibly damaging Het
Rab2b T A 14: 52,266,242 H141L possibly damaging Het
Rev3l A G 10: 39,828,416 K279E probably benign Het
Rnf111 G T 9: 70,450,396 T607N probably benign Het
Scn8a C A 15: 101,016,503 S1130* probably null Het
Selenbp1 A G 3: 94,944,568 *473W probably null Het
Sh3bp4 A C 1: 89,144,273 D281A probably damaging Het
Skint5 T A 4: 113,629,117 probably null Het
Slc1a4 A G 11: 20,308,452 L249P probably damaging Het
Slc45a2 T A 15: 11,012,576 S222T probably benign Het
Slc7a4 A G 16: 17,574,391 F393S probably damaging Het
Slc9a2 A T 1: 40,761,918 D536V possibly damaging Het
Stra6 T A 9: 58,140,832 probably benign Het
Tmem145 A G 7: 25,307,825 D156G probably benign Het
Tns3 A C 11: 8,451,119 F1060V probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trappc8 A G 18: 20,867,808 S273P probably benign Het
Trmt11 A G 10: 30,559,204 S320P probably benign Het
Ugt1a6a A T 1: 88,139,258 Y262F probably benign Het
Vmn1r73 G A 7: 11,756,831 C192Y probably benign Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Vmn2r25 T A 6: 123,853,003 D63V possibly damaging Het
Vps13b C T 15: 35,646,132 H1461Y possibly damaging Het
Ythdc2 A T 18: 44,887,631 E1427D probably benign Het
Zbtb26 A G 2: 37,436,956 F23L probably benign Het
Zfp62 T A 11: 49,217,805 *908R probably null Het
Zfp975 A T 7: 42,662,945 N81K probably benign Het
Zkscan16 G A 4: 58,951,918 V198M probably damaging Het
Other mutations in Dlg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Dlg2 APN 7 91965645 missense probably damaging 1.00
IGL01111:Dlg2 APN 7 91449763 missense possibly damaging 0.84
IGL01122:Dlg2 APN 7 92442608 missense possibly damaging 0.58
IGL01296:Dlg2 APN 7 91940059 missense probably damaging 1.00
IGL02063:Dlg2 APN 7 91810476 splice site probably benign
IGL02233:Dlg2 APN 7 92444538 missense probably damaging 1.00
IGL02519:Dlg2 APN 7 91940115 missense possibly damaging 0.54
IGL02833:Dlg2 APN 7 92431127 missense probably damaging 1.00
IGL03166:Dlg2 APN 7 91900730 splice site probably benign
R0932:Dlg2 UTSW 7 92375637 missense probably damaging 1.00
R1129:Dlg2 UTSW 7 92431174 splice site probably null
R1245:Dlg2 UTSW 7 92442595 splice site probably benign
R1319:Dlg2 UTSW 7 92438023 missense probably damaging 0.98
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1596:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1650:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1868:Dlg2 UTSW 7 92386952 nonsense probably null
R2006:Dlg2 UTSW 7 91965617 missense possibly damaging 0.95
R2026:Dlg2 UTSW 7 91965723 missense probably damaging 1.00
R2281:Dlg2 UTSW 7 92438041 missense probably damaging 1.00
R3721:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3722:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3793:Dlg2 UTSW 7 91810535 splice site probably benign
R4120:Dlg2 UTSW 7 91965638 missense probably damaging 1.00
R4444:Dlg2 UTSW 7 92088593 missense probably damaging 1.00
R4672:Dlg2 UTSW 7 92286535 missense probably damaging 1.00
R4678:Dlg2 UTSW 7 92428580 missense possibly damaging 0.89
R4695:Dlg2 UTSW 7 92437962 splice site probably null
R5106:Dlg2 UTSW 7 92442686 missense probably damaging 0.99
R5355:Dlg2 UTSW 7 91449803 missense probably benign 0.41
R5385:Dlg2 UTSW 7 92088576 missense probably damaging 0.96
R5403:Dlg2 UTSW 7 92431002 missense probably damaging 1.00
R5504:Dlg2 UTSW 7 92442657 missense probably damaging 1.00
R5569:Dlg2 UTSW 7 91968180 missense probably benign 0.01
R5573:Dlg2 UTSW 7 91997324 splice site probably null
R5848:Dlg2 UTSW 7 92444527 missense probably benign 0.41
R5863:Dlg2 UTSW 7 91711779 missense probably benign 0.01
R5907:Dlg2 UTSW 7 91997371 intron probably benign
R6455:Dlg2 UTSW 7 92444508 splice site probably null
R6486:Dlg2 UTSW 7 91872374 critical splice acceptor site probably null
R6817:Dlg2 UTSW 7 91965664 missense probably benign 0.07
R7082:Dlg2 UTSW 7 90731984 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATTTTACTGTGGCAAGC -3'
(R):5'- TTCATGGATGATGATAGATGCTGAC -3'

Sequencing Primer
(F):5'- ACTGTGGCAAGCTACTATAGTTG -3'
(R):5'- TATATGCCTCAGTACAGGGGAATGTC -3'
Posted On2015-10-08