Incidental Mutation 'R4632:Chpf2'
ID349265
Institutional Source Beutler Lab
Gene Symbol Chpf2
Ensembl Gene ENSMUSG00000038181
Gene Namechondroitin polymerizing factor 2
Synonyms2010209O12Rik
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24586741-24594556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24591831 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 592 (T592A)
Ref Sequence ENSEMBL: ENSMUSP00000112804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably benign
Transcript: ENSMUST00000030791
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088295
AA Change: T592A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181
AA Change: T592A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably benign
Transcript: ENSMUST00000121863
AA Change: T592A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181
AA Change: T592A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147857
Predicted Effect probably benign
Transcript: ENSMUST00000195943
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198521
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Chpf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chpf2 APN 5 24592261 missense probably damaging 1.00
IGL02110:Chpf2 APN 5 24591712 missense probably damaging 1.00
IGL02625:Chpf2 APN 5 24591711 nonsense probably null
IGL02673:Chpf2 APN 5 24591304 missense probably benign 0.21
R0545:Chpf2 UTSW 5 24590324 missense possibly damaging 0.89
R0571:Chpf2 UTSW 5 24590427 missense probably damaging 1.00
R0732:Chpf2 UTSW 5 24590421 start codon destroyed probably null 0.94
R1196:Chpf2 UTSW 5 24589648 missense possibly damaging 0.61
R2051:Chpf2 UTSW 5 24591276 missense probably benign 0.00
R2057:Chpf2 UTSW 5 24591222 missense probably damaging 1.00
R2147:Chpf2 UTSW 5 24592035 missense probably damaging 1.00
R3719:Chpf2 UTSW 5 24590312 nonsense probably null
R4168:Chpf2 UTSW 5 24591790 missense possibly damaging 0.86
R5278:Chpf2 UTSW 5 24588090 intron probably benign
R5481:Chpf2 UTSW 5 24589342 missense probably damaging 1.00
R5853:Chpf2 UTSW 5 24592192 missense probably damaging 1.00
R5914:Chpf2 UTSW 5 24592423 unclassified probably benign
R6010:Chpf2 UTSW 5 24591919 missense probably damaging 1.00
R6340:Chpf2 UTSW 5 24591775 missense probably damaging 0.98
R6463:Chpf2 UTSW 5 24589526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAACATGCATTGCTCACCC -3'
(R):5'- AAGCCTGCCGGTCAAATCTG -3'

Sequencing Primer
(F):5'- AACATGCATTGCTCACCCTGTTG -3'
(R):5'- CTAGAAGGGTCCACACCAGG -3'
Posted On2015-10-08