Incidental Mutation 'R4632:Ppfia2'
ID349293
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
SynonymsLiprin-alpha2, E130120L08Rik
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location106470339-106935952 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 106836044 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
Predicted Effect probably null
Transcript: ENSMUST00000029404
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217854
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106819492 missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106858207 missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106913699 missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106836048 splice site probably benign
IGL01899:Ppfia2 APN 10 106915751 critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106904845 missense probably null 0.83
IGL02143:Ppfia2 APN 10 106857499 missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106800785 missense probably benign
IGL02565:Ppfia2 APN 10 106863386 critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106828928 missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106906394 missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106800776 missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106767487 missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106896507 missense possibly damaging 0.76
PIT4458001:Ppfia2 UTSW 10 106927847 missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0323:Ppfia2 UTSW 10 106896420 missense possibly damaging 0.84
R0391:Ppfia2 UTSW 10 106830714 splice site probably benign
R0667:Ppfia2 UTSW 10 106913694 missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106927731 missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106819511 missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106830657 missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106830568 missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106915672 splice site probably null
R1780:Ppfia2 UTSW 10 106896507 missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106927710 missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106474677 missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106837299 missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106837329 missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106762111 missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106854980 missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106819490 missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106865407 splice site probably null
R3113:Ppfia2 UTSW 10 106906395 nonsense probably null
R3968:Ppfia2 UTSW 10 106906521 missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106865406 splice site probably null
R4718:Ppfia2 UTSW 10 106858285 missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106915690 missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106865363 nonsense probably null
R5029:Ppfia2 UTSW 10 106857443 missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106835760 missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106904847 critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106835701 missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106857569 missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106913594 missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106913698 missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106893500 missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106835725 missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106927772 missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106906458 nonsense probably null
R6992:Ppfia2 UTSW 10 106474854 missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106762109 missense probably damaging 1.00
X0021:Ppfia2 UTSW 10 106474677 missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106893434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCTGACATCATTTGCC -3'
(R):5'- ATGAGTACAGCTGGCTAGGAGC -3'

Sequencing Primer
(F):5'- GCTGACATCATTTGCCTATGATCTAG -3'
(R):5'- GCTAGGAGCAGTTACAACCTAGAC -3'
Posted On2015-10-08