Incidental Mutation 'R4632:Krt13'
ID349299
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Namekeratin 13
SynonymsK13, Krt-1.13, Krt1-13
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100117327-100121566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100121224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 91 (L91P)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007275
AA Change: L91P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: L91P

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100119713 missense probably damaging 1.00
IGL02532:Krt13 APN 11 100119369 missense probably damaging 1.00
IGL02934:Krt13 APN 11 100119084 missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100120036 missense probably damaging 0.98
R0092:Krt13 UTSW 11 100121432 nonsense probably null
R0722:Krt13 UTSW 11 100119153 missense probably damaging 1.00
R1228:Krt13 UTSW 11 100121477 missense probably benign 0.18
R1400:Krt13 UTSW 11 100121284 missense probably damaging 1.00
R1751:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2421:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2869:Krt13 UTSW 11 100117649 missense unknown
R2869:Krt13 UTSW 11 100117649 missense unknown
R4421:Krt13 UTSW 11 100118935 missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100118001 missense unknown
R4520:Krt13 UTSW 11 100119348 missense probably damaging 0.99
R4656:Krt13 UTSW 11 100119363 missense probably damaging 1.00
R4872:Krt13 UTSW 11 100121506 start gained probably benign
R5709:Krt13 UTSW 11 100117643 missense unknown
R6014:Krt13 UTSW 11 100117611 missense unknown
R6323:Krt13 UTSW 11 100121150 missense probably damaging 1.00
R6391:Krt13 UTSW 11 100119376 missense probably damaging 0.96
X0013:Krt13 UTSW 11 100119348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGAGGAAAACTTCTTAGCATCAG -3'
(R):5'- TTTGTCACTGGAGGGTCAGC -3'

Sequencing Primer
(F):5'- ACTTCTTAGCATCAGAGGCC -3'
(R):5'- CACTGGAGGGTCAGCTGGAG -3'
Posted On2015-10-08