Incidental Mutation 'R4632:Arl16'
ID349301
Institutional Source Beutler Lab
Gene Symbol Arl16
Ensembl Gene ENSMUSG00000057594
Gene NameADP-ribosylation factor-like 16
Synonyms
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120464866-120467607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120465784 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 130 (S130P)
Ref Sequence ENSEMBL: ENSMUSP00000076188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000058370] [ENSMUST00000076921] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
Predicted Effect probably benign
Transcript: ENSMUST00000026900
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058370
SMART Domains Protein: ENSMUSP00000062540
Gene: ENSMUSG00000049957

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 160 189 N/A INTRINSIC
low complexity region 219 245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076921
AA Change: S130P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076188
Gene: ENSMUSG00000057594
AA Change: S130P

DomainStartEndE-ValueType
Pfam:Arf 1 169 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106203
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106205
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137639
Predicted Effect probably benign
Transcript: ENSMUST00000140862
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154136
Predicted Effect probably benign
Transcript: ENSMUST00000176120
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). This protein has been shown to have an inhibitory role in the cellular antiviral response. This gene product interacts with the C-terminal domain of the DEXD/H-box helicase 58 (DDX58) gene product. This interaction was found to suppress the association between the DDX58 gene product and RNA, thereby negatively regulating the activity of the DDX58 gene product. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Arl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1027:Arl16 UTSW 11 120465696 missense probably benign 0.03
R1773:Arl16 UTSW 11 120465763 missense possibly damaging 0.52
R1820:Arl16 UTSW 11 120466761 missense probably damaging 0.99
R5915:Arl16 UTSW 11 120466605 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGGCTCTCATGCATTTGCC -3'
(R):5'- TAAAATGTATGGGTCTAAGGGCTGG -3'

Sequencing Primer
(F):5'- TCATGCATTTGCCTCCTAGG -3'
(R):5'- TCTAAGGGCTGGGCAGG -3'
Posted On2015-10-08