Incidental Mutation 'R4632:2010111I01Rik'
ID349304
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63068092 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 393 (S393P)
Ref Sequence ENSEMBL: ENSMUSP00000089148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560]
Predicted Effect probably benign
Transcript: ENSMUST00000021911
AA Change: S392P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: S392P

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091560
AA Change: S393P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: S393P

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220863
AA Change: S284P
Predicted Effect probably benign
Transcript: ENSMUST00000221676
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 unclassified probably null
R1233:2010111I01Rik UTSW 13 63199520 missense probably damaging 0.96
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3076:2010111I01Rik UTSW 13 63240115 missense probably damaging 0.96
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4512:2010111I01Rik UTSW 13 63156667 missense probably damaging 0.99
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4597:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6048:2010111I01Rik UTSW 13 63240325 missense probably damaging 0.99
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTTTCACTGCTGCCCAAAAGC -3'
(R):5'- AGCAGCATACCTGGCCATTC -3'

Sequencing Primer
(F):5'- CTGGGATTTGAACTCAGGACC -3'
(R):5'- TGGCCATTCCCAGACTTGG -3'
Posted On2015-10-08