Incidental Mutation 'R4633:Trim24'
ID349342
Institutional Source Beutler Lab
Gene Symbol Trim24
Ensembl Gene ENSMUSG00000029833
Gene Nametripartite motif-containing 24
SynonymsA130082H20Rik, D430004I05Rik, TIF1alpha, Tif1a
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location37870811-37966296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37956436 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 650 (I650K)
Ref Sequence ENSEMBL: ENSMUSP00000113063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]
Predicted Effect probably damaging
Transcript: ENSMUST00000031859
AA Change: I684K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: I684K

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 2.5e-10 SMART
BBOX 158 205 2e-13 SMART
BBOX 218 259 7e-14 SMART
BBC 266 392 3e-44 SMART
low complexity region 474 491 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
low complexity region 573 598 N/A INTRINSIC
low complexity region 686 709 N/A INTRINSIC
low complexity region 759 774 N/A INTRINSIC
PHD 829 872 2.1e-13 SMART
BROMO 902 1007 2.4e-40 SMART
low complexity region 1025 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120238
AA Change: I614K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: I614K

DomainStartEndE-ValueType
BBOX 88 135 2e-13 SMART
BBOX 148 189 6.8e-14 SMART
BBC 196 322 3e-44 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 616 639 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
PHD 759 802 2e-13 SMART
BROMO 832 937 2.4e-40 SMART
low complexity region 955 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120428
AA Change: I650K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: I650K

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 5.22e-8 SMART
BBOX 158 205 6.27e-11 SMART
BBOX 218 259 2.22e-11 SMART
BBC 266 392 5.86e-42 SMART
low complexity region 539 564 N/A INTRINSIC
low complexity region 652 675 N/A INTRINSIC
low complexity region 725 740 N/A INTRINSIC
PHD 795 838 3.15e-11 SMART
BROMO 868 973 3.95e-38 SMART
low complexity region 991 999 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135387
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Trim24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Trim24 APN 6 37903648 missense possibly damaging 0.76
IGL01307:Trim24 APN 6 37965635 missense possibly damaging 0.81
IGL01790:Trim24 APN 6 37945613 missense probably benign
IGL02525:Trim24 APN 6 37945718 missense probably damaging 0.99
IGL02557:Trim24 APN 6 37965499 critical splice acceptor site probably null
IGL02671:Trim24 APN 6 37960784 missense probably damaging 1.00
IGL02795:Trim24 APN 6 37919389 missense probably damaging 1.00
IGL02877:Trim24 APN 6 37965646 missense probably damaging 1.00
IGL02889:Trim24 APN 6 37957761 missense probably benign 0.02
IGL02930:Trim24 APN 6 37951445 splice site probably benign
IGL03076:Trim24 APN 6 37965632 missense probably damaging 0.98
Lithe UTSW 6 37958569 missense probably damaging 1.00
Nervous UTSW 6 37957729 missense probably damaging 1.00
pliant UTSW 6 37919491 critical splice donor site probably null
qualmish UTSW 6 37903652 critical splice donor site probably null
Queasy UTSW 6 37908305 missense probably damaging 0.99
squeamish UTSW 6 37915202 nonsense probably null
Uneasy UTSW 6 37956477 critical splice donor site probably null
PIT4651001:Trim24 UTSW 6 37900732 critical splice donor site probably null
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0183:Trim24 UTSW 6 37943480 missense possibly damaging 0.90
R0471:Trim24 UTSW 6 37915195 missense possibly damaging 0.94
R0485:Trim24 UTSW 6 37957066 missense probably damaging 1.00
R0606:Trim24 UTSW 6 37871234 missense probably benign
R0609:Trim24 UTSW 6 37957783 missense probably damaging 1.00
R0637:Trim24 UTSW 6 37958559 splice site probably null
R0734:Trim24 UTSW 6 37919465 missense possibly damaging 0.86
R0855:Trim24 UTSW 6 37915202 nonsense probably null
R1131:Trim24 UTSW 6 37957782 missense probably damaging 1.00
R1141:Trim24 UTSW 6 37915293 missense probably damaging 1.00
R1159:Trim24 UTSW 6 37956477 critical splice donor site probably null
R1460:Trim24 UTSW 6 37964826 missense probably damaging 1.00
R1672:Trim24 UTSW 6 37915279 missense probably damaging 1.00
R1868:Trim24 UTSW 6 37951512 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1894:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1913:Trim24 UTSW 6 37957815 missense probably damaging 1.00
R2254:Trim24 UTSW 6 37958677 missense probably benign
R2511:Trim24 UTSW 6 37903652 critical splice donor site probably null
R2849:Trim24 UTSW 6 37956453 missense probably damaging 0.99
R3878:Trim24 UTSW 6 37964773 missense probably benign 0.14
R4084:Trim24 UTSW 6 37915257 missense probably damaging 1.00
R4235:Trim24 UTSW 6 37964740 missense probably damaging 1.00
R4292:Trim24 UTSW 6 37900692 missense possibly damaging 0.91
R4651:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4652:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4686:Trim24 UTSW 6 37908305 missense probably damaging 0.99
R5000:Trim24 UTSW 6 37958612 missense probably benign 0.01
R5213:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R5258:Trim24 UTSW 6 37919400 missense probably damaging 0.99
R5292:Trim24 UTSW 6 37903604 missense probably benign 0.23
R5395:Trim24 UTSW 6 37957744 missense probably damaging 1.00
R5547:Trim24 UTSW 6 37965550 missense probably damaging 1.00
R5666:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5670:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5849:Trim24 UTSW 6 37957729 missense probably damaging 1.00
R5927:Trim24 UTSW 6 37958569 missense probably damaging 1.00
R5932:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R6286:Trim24 UTSW 6 37919491 critical splice donor site probably null
R6374:Trim24 UTSW 6 37953549 missense probably benign 0.12
R6449:Trim24 UTSW 6 37903652 critical splice donor site probably null
R6723:Trim24 UTSW 6 37951468 missense probably benign 0.00
R6731:Trim24 UTSW 6 37943485 missense probably damaging 0.99
R6975:Trim24 UTSW 6 37919492 critical splice donor site probably null
R7000:Trim24 UTSW 6 37958678 missense probably benign 0.24
R7126:Trim24 UTSW 6 37919457 missense probably damaging 1.00
R7162:Trim24 UTSW 6 37965521 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCGTCATGACTGTAAACTTTGG -3'
(R):5'- TCGATGATGACAGAAAGGCC -3'

Sequencing Primer
(F):5'- GTCATGACTGTAAACTTTGGTGTAAC -3'
(R):5'- TGTATTAGGCAGCATCAGCAACCTAG -3'
Posted On2015-10-08