Incidental Mutation 'R4633:Lrriq1'
ID349364
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 103200563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 910 (R910*)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
Predicted Effect probably null
Transcript: ENSMUST00000166240
AA Change: R910*
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: R910*

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Meta Mutation Damage Score 0.666 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCCCAGGATTTAATATCTAAGTCC -3'
(R):5'- CCTCTGGATAGTATAGCTATTTCCATG -3'

Sequencing Primer
(F):5'- GTCCTGGAGATCAACCTAAAGTGC -3'
(R):5'- CTGCTTAGGAAAACCACATTG -3'
Posted On2015-10-08