Incidental Mutation 'R4633:Gm884'
ID349370
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 103619131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: N670K
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: N670K

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGACTTCCAGGTCCAAAG -3'
(R):5'- CACGAGGTAACAGGTCTACC -3'

Sequencing Primer
(F):5'- TTCCAGGTCCAAAGACTGAAATG -3'
(R):5'- GGTCATGGCCAAGTTTATTCTCCAG -3'
Posted On2015-10-08