Incidental Mutation 'R4634:4930548H24Rik'
ID349396
Institutional Source Beutler Lab
Gene Symbol 4930548H24Rik
Ensembl Gene ENSMUSG00000029138
Gene NameRIKEN cDNA 4930548H24 gene
Synonyms
MMRRC Submission 042009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4634 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31485740-31488476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31488091 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 396 (R396Q)
Ref Sequence ENSEMBL: ENSMUSP00000031020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031020]
Predicted Effect probably benign
Transcript: ENSMUST00000031020
AA Change: R396Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031020
Gene: ENSMUSG00000029138
AA Change: R396Q

DomainStartEndE-ValueType
coiled coil region 151 195 N/A INTRINSIC
Pfam:DUF4515 202 407 2e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202605
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A G 15: 74,584,429 probably benign Het
Atm T C 9: 53,531,733 T77A probably benign Het
Brd8 T C 18: 34,608,484 M311V possibly damaging Het
Cand2 T A 6: 115,797,987 I1052N probably damaging Het
Ceacam16 T A 7: 19,858,606 M126L probably benign Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Cln8 C T 8: 14,894,842 T52I probably damaging Het
Cops2 C A 2: 125,840,480 D194Y probably damaging Het
Csf1 C T 3: 107,749,167 V71M probably damaging Het
Dip2b T C 15: 100,160,491 F183S probably damaging Het
Ears2 T A 7: 122,044,609 K375N probably benign Het
Fbn1 C A 2: 125,344,061 G1596C probably damaging Het
Fscn2 A T 11: 120,367,720 D390V possibly damaging Het
Gm42669 A T 5: 107,508,213 I781F possibly damaging Het
Gprin1 G T 13: 54,738,058 P801Q probably damaging Het
Hira C A 16: 18,946,400 S609R probably damaging Het
Htt G T 5: 34,875,948 K1853N probably benign Het
Kif2c T C 4: 117,178,240 I4V probably benign Het
Marveld2 A G 13: 100,611,939 Y211H probably damaging Het
Myd88 G A 9: 119,338,109 probably null Het
Nup153 A T 13: 46,687,230 N967K possibly damaging Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rabepk A G 2: 34,780,740 M228T probably damaging Het
Rcn3 T A 7: 45,088,668 D92V probably damaging Het
Sec1 T A 7: 45,678,873 Y250F probably damaging Het
Slc39a4 T C 15: 76,614,493 T334A probably benign Het
Trip11 G T 12: 101,837,616 T1669K probably damaging Het
Ttbk2 A G 2: 120,740,192 L1091P probably damaging Het
Vmn1r231 A G 17: 20,890,398 V85A possibly damaging Het
Zfp280b T C 10: 76,038,829 C181R probably benign Het
Other mutations in 4930548H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:4930548H24Rik APN 5 31487427 missense probably benign 0.00
IGL02009:4930548H24Rik APN 5 31487491 missense probably benign 0.00
FR4304:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4340:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4342:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4589:4930548H24Rik UTSW 5 31487373 small deletion probably benign
LCD18:4930548H24Rik UTSW 5 31487373 small deletion probably benign
PIT4486001:4930548H24Rik UTSW 5 31487743 missense probably damaging 0.99
R0650:4930548H24Rik UTSW 5 31485968 unclassified probably benign
R1366:4930548H24Rik UTSW 5 31487517 missense probably benign 0.07
R2050:4930548H24Rik UTSW 5 31486058 missense possibly damaging 0.68
R2070:4930548H24Rik UTSW 5 31487383 missense possibly damaging 0.91
R2862:4930548H24Rik UTSW 5 31485911 unclassified probably benign
R3965:4930548H24Rik UTSW 5 31487991 missense probably benign 0.02
R4299:4930548H24Rik UTSW 5 31487526 missense possibly damaging 0.82
R4635:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4637:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4887:4930548H24Rik UTSW 5 31486252 missense probably benign 0.19
R5587:4930548H24Rik UTSW 5 31486084 missense probably benign
R5897:4930548H24Rik UTSW 5 31485964 unclassified probably benign
R6181:4930548H24Rik UTSW 5 31488055 missense probably damaging 0.98
R6183:4930548H24Rik UTSW 5 31487976 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGGCAGGAGACCATAAC -3'
(R):5'- GGGGCCTAGTAGTTCTGAATC -3'

Sequencing Primer
(F):5'- GGAGACCATAACACCCCAGAGG -3'
(R):5'- GTAGTTCTGAATCTTCATTTTCTGGC -3'
Posted On2015-10-08