Incidental Mutation 'R4634:Fscn2'
ID349413
Institutional Source Beutler Lab
Gene Symbol Fscn2
Ensembl Gene ENSMUSG00000025380
Gene Namefascin actin-bundling protein 2
SynonymsC630046B20Rik, ahl8
MMRRC Submission 042009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4634 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120361534-120368168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120367720 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 390 (D390V)
Ref Sequence ENSEMBL: ENSMUSP00000026445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445] [ENSMUST00000026448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026445
AA Change: D390V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380
AA Change: D390V

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026448
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152556
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal generation with structural abnormalities of the outer segment and depressed rod and cone ERGs that worsen with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Adgrb1 A G 15: 74,584,429 probably benign Het
Atm T C 9: 53,531,733 T77A probably benign Het
Brd8 T C 18: 34,608,484 M311V possibly damaging Het
Cand2 T A 6: 115,797,987 I1052N probably damaging Het
Ceacam16 T A 7: 19,858,606 M126L probably benign Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Cln8 C T 8: 14,894,842 T52I probably damaging Het
Cops2 C A 2: 125,840,480 D194Y probably damaging Het
Csf1 C T 3: 107,749,167 V71M probably damaging Het
Dip2b T C 15: 100,160,491 F183S probably damaging Het
Ears2 T A 7: 122,044,609 K375N probably benign Het
Fbn1 C A 2: 125,344,061 G1596C probably damaging Het
Gm42669 A T 5: 107,508,213 I781F possibly damaging Het
Gprin1 G T 13: 54,738,058 P801Q probably damaging Het
Hira C A 16: 18,946,400 S609R probably damaging Het
Htt G T 5: 34,875,948 K1853N probably benign Het
Kif2c T C 4: 117,178,240 I4V probably benign Het
Marveld2 A G 13: 100,611,939 Y211H probably damaging Het
Myd88 G A 9: 119,338,109 probably null Het
Nup153 A T 13: 46,687,230 N967K possibly damaging Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rabepk A G 2: 34,780,740 M228T probably damaging Het
Rcn3 T A 7: 45,088,668 D92V probably damaging Het
Sec1 T A 7: 45,678,873 Y250F probably damaging Het
Slc39a4 T C 15: 76,614,493 T334A probably benign Het
Trip11 G T 12: 101,837,616 T1669K probably damaging Het
Ttbk2 A G 2: 120,740,192 L1091P probably damaging Het
Vmn1r231 A G 17: 20,890,398 V85A possibly damaging Het
Zfp280b T C 10: 76,038,829 C181R probably benign Het
Other mutations in Fscn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Fscn2 APN 11 120367305 missense probably damaging 0.99
IGL01767:Fscn2 APN 11 120367750 missense possibly damaging 0.82
IGL02212:Fscn2 APN 11 120362055 missense probably damaging 1.00
IGL02299:Fscn2 APN 11 120362199 missense probably benign 0.09
IGL02494:Fscn2 APN 11 120362402 missense probably benign 0.02
IGL02716:Fscn2 APN 11 120366724 missense probably benign 0.00
IGL02882:Fscn2 APN 11 120362499 missense probably benign
IGL02986:Fscn2 APN 11 120367350 missense possibly damaging 0.74
ANU74:Fscn2 UTSW 11 120362336 missense probably damaging 1.00
R0277:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0323:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0513:Fscn2 UTSW 11 120361880 missense probably damaging 1.00
R1451:Fscn2 UTSW 11 120362022 missense probably damaging 0.98
R1620:Fscn2 UTSW 11 120366685 missense probably damaging 1.00
R1736:Fscn2 UTSW 11 120368026 missense probably damaging 1.00
R2212:Fscn2 UTSW 11 120361591 start gained probably benign
R2327:Fscn2 UTSW 11 120366701 missense probably damaging 1.00
R2384:Fscn2 UTSW 11 120366733 missense possibly damaging 0.48
R2397:Fscn2 UTSW 11 120362169 missense probably damaging 1.00
R4624:Fscn2 UTSW 11 120367343 missense probably benign 0.21
R4784:Fscn2 UTSW 11 120367987 missense possibly damaging 0.82
R5062:Fscn2 UTSW 11 120366749 missense probably damaging 1.00
R5084:Fscn2 UTSW 11 120361860 missense probably damaging 0.96
R5514:Fscn2 UTSW 11 120368032 missense probably damaging 1.00
R5780:Fscn2 UTSW 11 120366668 missense probably benign 0.14
R6073:Fscn2 UTSW 11 120361787 nonsense probably null
R6345:Fscn2 UTSW 11 120362027 missense probably damaging 0.99
R7110:Fscn2 UTSW 11 120366754 missense probably benign 0.19
R7170:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7171:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7538:Fscn2 UTSW 11 120367326 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GTAACGAATGCCTGCTTCTG -3'
(R):5'- TGTGTACCAGAACCCACCTC -3'

Sequencing Primer
(F):5'- GCCAGTCTCCTTGCCACAG -3'
(R):5'- CTGGGGGCAAGGCTGGAG -3'
Posted On2015-10-08