Incidental Mutation 'R4635:Tmc3'
ID349440
Institutional Source Beutler Lab
Gene Symbol Tmc3
Ensembl Gene ENSMUSG00000038540
Gene Nametransmembrane channel-like gene family 3
Synonyms
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4635 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83584927-83625614 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 83585082 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039317] [ENSMUST00000164944]
Predicted Effect probably benign
Transcript: ENSMUST00000039317
SMART Domains Protein: ENSMUSP00000046028
Gene: ENSMUSG00000038540

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 5e-42 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1071 1089 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163297
Predicted Effect probably benign
Transcript: ENSMUST00000164944
SMART Domains Protein: ENSMUSP00000130348
Gene: ENSMUSG00000038540

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 1.1e-45 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1042 1060 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165388
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Tmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tmc3 APN 7 83603474 missense probably null 1.00
IGL01372:Tmc3 APN 7 83612538 missense probably damaging 1.00
IGL02072:Tmc3 APN 7 83615940 missense probably benign 0.00
IGL02168:Tmc3 APN 7 83619995 missense possibly damaging 0.87
IGL02344:Tmc3 APN 7 83609094 missense probably benign 0.00
IGL02421:Tmc3 APN 7 83622744 missense probably benign
IGL02604:Tmc3 APN 7 83622619 missense possibly damaging 0.85
IGL02863:Tmc3 APN 7 83622286 missense probably benign 0.04
IGL02863:Tmc3 APN 7 83622285 missense possibly damaging 0.61
IGL03058:Tmc3 APN 7 83615886 missense possibly damaging 0.91
IGL03303:Tmc3 APN 7 83590725 splice site probably benign
F5770:Tmc3 UTSW 7 83622505 missense probably benign 0.01
R0133:Tmc3 UTSW 7 83612473 missense probably damaging 1.00
R0147:Tmc3 UTSW 7 83607742 missense probably damaging 1.00
R0304:Tmc3 UTSW 7 83596139 missense probably damaging 1.00
R0320:Tmc3 UTSW 7 83607819 splice site probably benign
R0478:Tmc3 UTSW 7 83622152 missense possibly damaging 0.66
R0714:Tmc3 UTSW 7 83616761 missense possibly damaging 0.94
R1471:Tmc3 UTSW 7 83598290 missense probably damaging 1.00
R1725:Tmc3 UTSW 7 83604732 missense probably damaging 1.00
R1775:Tmc3 UTSW 7 83612532 missense probably benign 0.39
R2176:Tmc3 UTSW 7 83609308 missense probably damaging 1.00
R4001:Tmc3 UTSW 7 83620063 missense probably benign 0.01
R4229:Tmc3 UTSW 7 83597402 intron probably benign
R4715:Tmc3 UTSW 7 83622396 missense probably benign 0.05
R4789:Tmc3 UTSW 7 83622538 missense probably damaging 0.99
R4998:Tmc3 UTSW 7 83622321 missense probably benign 0.16
R5044:Tmc3 UTSW 7 83609118 missense probably benign 0.00
R5108:Tmc3 UTSW 7 83619948 missense probably damaging 0.97
R5119:Tmc3 UTSW 7 83615010 missense probably damaging 1.00
R5428:Tmc3 UTSW 7 83612547 missense probably damaging 1.00
R5447:Tmc3 UTSW 7 83622361 missense possibly damaging 0.63
R5767:Tmc3 UTSW 7 83599982 missense probably benign 0.43
R5801:Tmc3 UTSW 7 83622478 missense possibly damaging 0.94
R6115:Tmc3 UTSW 7 83614962 missense possibly damaging 0.47
R6193:Tmc3 UTSW 7 83603335 missense probably benign 0.26
R6436:Tmc3 UTSW 7 83598487 missense probably damaging 1.00
R6478:Tmc3 UTSW 7 83622316 missense probably benign 0.31
R6648:Tmc3 UTSW 7 83597543 missense probably damaging 1.00
R6849:Tmc3 UTSW 7 83586357 missense probably damaging 1.00
R7030:Tmc3 UTSW 7 83616817 splice site probably null
R7085:Tmc3 UTSW 7 83622145 missense possibly damaging 0.88
V7581:Tmc3 UTSW 7 83622505 missense probably benign 0.01
Z1088:Tmc3 UTSW 7 83603468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGTATGACCCTGGCTGC -3'
(R):5'- TGGGAGCTTGCAACTGTCTTC -3'

Sequencing Primer
(F):5'- GGCTGCCCTCCTGGTTTTTC -3'
(R):5'- AGCATTGCTGTGGTCGCC -3'
Posted On2015-10-08