Incidental Mutation 'R4635:Chd3'
ID349449
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Namechromodomain helicase DNA binding protein 3
SynonymsChd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R4635 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location69343273-69369406 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGCTGCCGCTGCCGC to TGCTGCCGCTGCCGCTGCCGC at 69362187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]
Predicted Effect probably benign
Transcript: ENSMUST00000092971
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108661
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128981
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144701
SMART Domains Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
PHD 84 127 1.54e-14 SMART
RING 85 126 4.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154046
SMART Domains Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
PHD 86 129 1.54e-14 SMART
RING 87 128 4.25e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69357062 missense probably damaging 0.96
IGL00551:Chd3 APN 11 69346629 missense probably damaging 1.00
IGL00661:Chd3 APN 11 69357383 missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69349871 missense probably damaging 0.98
IGL01075:Chd3 APN 11 69359965 missense probably damaging 1.00
IGL01309:Chd3 APN 11 69357731 missense probably damaging 0.99
IGL01317:Chd3 APN 11 69353211 missense probably damaging 1.00
IGL01374:Chd3 APN 11 69359980 missense probably damaging 0.99
IGL01444:Chd3 APN 11 69348742 missense probably benign 0.28
IGL01617:Chd3 APN 11 69358234 unclassified probably benign
IGL01635:Chd3 APN 11 69361250 splice site probably benign
IGL01942:Chd3 APN 11 69350105 critical splice donor site probably null
IGL01962:Chd3 APN 11 69357493 missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69360675 missense probably damaging 0.99
IGL02022:Chd3 APN 11 69361060 missense probably damaging 1.00
IGL02098:Chd3 APN 11 69359829 missense probably damaging 1.00
IGL02218:Chd3 APN 11 69352094 unclassified probably benign
IGL02415:Chd3 APN 11 69348913 splice site probably benign
IGL02648:Chd3 APN 11 69352150 missense probably damaging 1.00
IGL02951:Chd3 APN 11 69361048 critical splice donor site probably null
IGL03030:Chd3 APN 11 69354404 missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69361196 nonsense probably null
IGL03168:Chd3 APN 11 69348915 splice site probably benign
IGL03327:Chd3 APN 11 69350186 missense probably damaging 1.00
burg UTSW 11 69356554 missense probably damaging 1.00
Fortress UTSW 11 69364050 nonsense probably null
redoubt UTSW 11 69353901 unclassified probably benign
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0056:Chd3 UTSW 11 69359913 unclassified probably benign
R0129:Chd3 UTSW 11 69348501 nonsense probably null
R0130:Chd3 UTSW 11 69359830 missense probably damaging 1.00
R0309:Chd3 UTSW 11 69357018 missense probably damaging 1.00
R0330:Chd3 UTSW 11 69356333 missense probably damaging 1.00
R0449:Chd3 UTSW 11 69357541 missense probably damaging 0.98
R0502:Chd3 UTSW 11 69354105 missense probably damaging 0.98
R0540:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0571:Chd3 UTSW 11 69361669 critical splice donor site probably null
R0607:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0616:Chd3 UTSW 11 69345487 missense probably damaging 0.96
R0630:Chd3 UTSW 11 69347195 missense probably damaging 1.00
R1436:Chd3 UTSW 11 69357574 splice site probably null
R1484:Chd3 UTSW 11 69359899 missense probably benign 0.17
R1741:Chd3 UTSW 11 69355654 missense probably damaging 1.00
R1748:Chd3 UTSW 11 69364697 missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69353901 unclassified probably benign
R1833:Chd3 UTSW 11 69354123 missense probably damaging 1.00
R2012:Chd3 UTSW 11 69349052 missense probably benign 0.01
R2101:Chd3 UTSW 11 69349051 missense probably benign
R2147:Chd3 UTSW 11 69349028 missense probably benign 0.00
R2513:Chd3 UTSW 11 69360645 missense probably damaging 1.00
R2877:Chd3 UTSW 11 69361172 nonsense probably null
R2879:Chd3 UTSW 11 69364098 missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2881:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2973:Chd3 UTSW 11 69360616 missense probably damaging 1.00
R3611:Chd3 UTSW 11 69362147 missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69364050 nonsense probably null
R3845:Chd3 UTSW 11 69346759 missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69359185 missense probably damaging 0.98
R4007:Chd3 UTSW 11 69349001 missense probably benign
R4115:Chd3 UTSW 11 69357517 missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69349877 missense probably benign 0.00
R4612:Chd3 UTSW 11 69353209 nonsense probably null
R4622:Chd3 UTSW 11 69349008 missense probably damaging 0.98
R4634:Chd3 UTSW 11 69362187 unclassified probably benign
R4859:Chd3 UTSW 11 69359896 missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69354208 unclassified probably benign
R5173:Chd3 UTSW 11 69369243 unclassified probably benign
R5287:Chd3 UTSW 11 69349069 splice site probably null
R5403:Chd3 UTSW 11 69349069 splice site probably null
R5511:Chd3 UTSW 11 69361475 missense probably damaging 1.00
R5666:Chd3 UTSW 11 69353351 missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69361435 missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69352118 missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69349237 missense probably benign
R6211:Chd3 UTSW 11 69352677 missense probably damaging 1.00
R6215:Chd3 UTSW 11 69356554 missense probably damaging 1.00
R6217:Chd3 UTSW 11 69345535 missense probably damaging 1.00
R6302:Chd3 UTSW 11 69353778 missense probably damaging 0.98
R6329:Chd3 UTSW 11 69361684 missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69364031 missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69352545 critical splice donor site probably null
R6453:Chd3 UTSW 11 69350112 nonsense probably null
R6548:Chd3 UTSW 11 69362060 nonsense probably null
R6582:Chd3 UTSW 11 69369156 unclassified probably benign
R6721:Chd3 UTSW 11 69369219 unclassified probably benign
R6776:Chd3 UTSW 11 69354470 missense probably damaging 1.00
R6900:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69369201 missense unknown
R7136:Chd3 UTSW 11 69348438 missense probably null 0.37
R7164:Chd3 UTSW 11 69362306 missense probably damaging 1.00
R7200:Chd3 UTSW 11 69364095 missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69369211 missense unknown
R7238:Chd3 UTSW 11 69364047 missense probably benign 0.31
R7316:Chd3 UTSW 11 69345568 missense probably damaging 0.99
X0022:Chd3 UTSW 11 69356258 missense probably damaging 1.00
X0062:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GGTTGTGGAGTTGCAAAGCC -3'
(R):5'- GACCATCTGTGAAGGGTCTG -3'

Sequencing Primer
(F):5'- GCAAAGCCATGCAGTCTG -3'
(R):5'- ACCATCTGTGAAGGGTCTGAGTTTTC -3'
Posted On2015-10-08