Incidental Mutation 'R4675:Ephx1'
ID349466
Institutional Source Beutler Lab
Gene Symbol Ephx1
Ensembl Gene ENSMUSG00000038776
Gene Nameepoxide hydrolase 1, microsomal
SynonymsEph-1, mEH, Eph1
MMRRC Submission 041930-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R4675 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180976210-181020904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180994691 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 220 (F220S)
Ref Sequence ENSEMBL: ENSMUSP00000106697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036928] [ENSMUST00000111068] [ENSMUST00000147585]
Predicted Effect probably damaging
Transcript: ENSMUST00000036928
AA Change: F220S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047551
Gene: ENSMUSG00000038776
AA Change: F220S

DomainStartEndE-ValueType
Pfam:EHN 50 160 2.1e-36 PFAM
Pfam:Abhydrolase_1 142 404 2.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111068
AA Change: F220S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106697
Gene: ENSMUSG00000038776
AA Change: F220S

DomainStartEndE-ValueType
Pfam:EHN 49 161 4.2e-38 PFAM
Pfam:Abhydrolase_6 144 430 3.7e-10 PFAM
Pfam:Abhydrolase_1 178 254 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147585
SMART Domains Protein: ENSMUSP00000122671
Gene: ENSMUSG00000038776

DomainStartEndE-ValueType
Pfam:EHN 49 130 2.6e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154133
AA Change: F96S
SMART Domains Protein: ENSMUSP00000114363
Gene: ENSMUSG00000038776
AA Change: F96S

DomainStartEndE-ValueType
Pfam:EHN 1 37 1.2e-8 PFAM
Pfam:Abhydrolase_1 19 247 2.3e-26 PFAM
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly resistant to DMBA-induced skin carcinogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 K291N probably damaging Het
Adgra1 A G 7: 139,876,186 T577A probably damaging Het
Akip1 T A 7: 109,708,981 I152N possibly damaging Het
Armc9 A G 1: 86,202,518 Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 T724S probably damaging Het
Bmp1 C A 14: 70,492,844 R416L probably damaging Het
Bmt2 G T 6: 13,663,301 A66E probably benign Het
Bscl2 A T 19: 8,848,159 D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Cntnap4 A G 8: 112,785,836 Y610C probably damaging Het
Col11a2 T C 17: 34,064,293 probably null Het
Col17a1 T C 19: 47,663,058 probably null Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Dgkz T A 2: 91,938,346 K697* probably null Het
Dnah7b T A 1: 46,217,157 D1873E possibly damaging Het
Dst G A 1: 34,275,703 E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 N210S probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fbn2 T A 18: 58,040,193 N2051I possibly damaging Het
Gabrg2 G A 11: 41,968,823 H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 S167P probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
Gm281 A T 14: 13,856,724 D462E probably benign Het
Heatr5a T C 12: 51,877,347 N2028D probably benign Het
Heca T C 10: 17,915,309 H333R probably benign Het
Herc1 T C 9: 66,391,458 S625P probably damaging Het
Ighv1-55 T C 12: 115,208,555 probably benign Het
Ighv5-8 G A 12: 113,655,157 S64N probably benign Het
Itga1 G T 13: 115,001,691 probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 P118S possibly damaging Het
Lat2 T C 5: 134,606,057 N100S probably damaging Het
Lrit3 T A 3: 129,788,472 D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Med21 T A 6: 146,650,193 L114H probably damaging Het
Mfap4 A T 11: 61,485,510 probably benign Het
Mpdz G A 4: 81,383,812 R233W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Neto2 T G 8: 85,669,704 H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 I206V probably benign Het
Olfr472 A G 7: 107,903,360 I214M probably damaging Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 M61L probably damaging Het
Olfr577 A G 7: 102,973,806 M62T probably damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Olfr878 T C 9: 37,919,586 *310R probably null Het
Pcbp3 A G 10: 76,771,035 L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 probably benign Het
Podxl G A 6: 31,526,644 T254M possibly damaging Het
Prr27 A C 5: 87,843,241 E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 V84F probably damaging Het
Rnf26 A T 9: 44,112,131 D273E probably benign Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rpl3l A G 17: 24,733,610 K239E probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Ryk A G 9: 102,891,216 D352G possibly damaging Het
Setd1b T A 5: 123,160,998 probably benign Het
Sh2b1 G A 7: 126,471,446 A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 K92* probably null Het
Slc39a10 A G 1: 46,817,984 probably benign Het
Slc47a1 G A 11: 61,363,031 T194I probably benign Het
Slc6a3 C A 13: 73,544,817 N185K probably damaging Het
Stag1 T C 9: 100,848,705 V391A probably damaging Het
Syne2 A C 12: 75,949,301 N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 R481I possibly damaging Het
Tfam A G 10: 71,233,395 S166P probably benign Het
Tmem63a A G 1: 180,956,491 H212R probably benign Het
Txndc11 T A 16: 11,084,881 Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 probably benign Het
Vmn1r204 A T 13: 22,556,792 M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 T119S probably benign Het
Vsig1 A G X: 140,933,112 D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 P1102L probably benign Het
Zfp715 T C 7: 43,300,020 Q172R probably benign Het
Zfp872 A G 9: 22,197,405 D53G probably damaging Het
Zswim8 G A 14: 20,714,613 D684N probably benign Het
Other mutations in Ephx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Ephx1 APN 1 180999821 missense possibly damaging 0.82
IGL00864:Ephx1 APN 1 180990451 missense probably damaging 1.00
IGL00972:Ephx1 APN 1 180999800 missense probably benign 0.02
IGL01577:Ephx1 APN 1 181001980 start codon destroyed probably null 0.96
IGL02718:Ephx1 APN 1 180999786 missense probably damaging 1.00
IGL03330:Ephx1 APN 1 180999806 missense possibly damaging 0.53
R1190:Ephx1 UTSW 1 180993929 missense probably benign 0.24
R1751:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R1767:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R2437:Ephx1 UTSW 1 180996096 missense probably damaging 1.00
R2484:Ephx1 UTSW 1 180989972 missense probably damaging 1.00
R3623:Ephx1 UTSW 1 180989933 missense probably benign 0.35
R3696:Ephx1 UTSW 1 180989951 missense probably benign 0.03
R4674:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4769:Ephx1 UTSW 1 180995978 missense possibly damaging 0.62
R4883:Ephx1 UTSW 1 181001923 missense possibly damaging 0.76
R6827:Ephx1 UTSW 1 180989888 missense probably damaging 1.00
R6974:Ephx1 UTSW 1 180999722 critical splice donor site probably null
R7147:Ephx1 UTSW 1 181001819 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAGGAAGTCCCAAGTCTCAGAG -3'
(R):5'- TGCAGGCGAATGTACACTTATG -3'

Sequencing Primer
(F):5'- TCTCAGAGACTGCTGAAGAGG -3'
(R):5'- CAGGCGAATGTACACTTATGGTTTG -3'
Posted On2015-10-08