Incidental Mutation 'R4675:Rpl13a'
ID349483
Institutional Source Beutler Lab
Gene Symbol Rpl13a
Ensembl Gene ENSMUSG00000074129
Gene Nameribosomal protein L13A
SynonymsTstap198-7, tum-transplantation antigen P198, tum-antigen, 1810026N22Rik
MMRRC Submission 041930-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R4675 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45125558-45128761 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 45126818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003521] [ENSMUST00000146760] [ENSMUST00000150350] [ENSMUST00000209212] [ENSMUST00000209238] [ENSMUST00000209467] [ENSMUST00000209711] [ENSMUST00000209812] [ENSMUST00000209815] [ENSMUST00000209927] [ENSMUST00000210191] [ENSMUST00000210818] [ENSMUST00000210918] [ENSMUST00000210931] [ENSMUST00000210967] [ENSMUST00000211037] [ENSMUST00000211429] [ENSMUST00000211725]
Predicted Effect probably benign
Transcript: ENSMUST00000003521
SMART Domains Protein: ENSMUSP00000003521
Gene: ENSMUSG00000003429

DomainStartEndE-ValueType
Pfam:Ribosomal_S17_N 5 73 1.9e-40 PFAM
Pfam:Ribosomal_S17 75 144 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125936
AA Change: M21K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131697
AA Change: D150E
Predicted Effect probably benign
Transcript: ENSMUST00000146760
SMART Domains Protein: ENSMUSP00000123506
Gene: ENSMUSG00000110206

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Flt3_lig 28 162 1.9e-94 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150350
SMART Domains Protein: ENSMUSP00000115722
Gene: ENSMUSG00000074129

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 6 122 7e-27 PFAM
low complexity region 169 180 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198528
Predicted Effect probably benign
Transcript: ENSMUST00000209212
Predicted Effect probably benign
Transcript: ENSMUST00000209238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209340
Predicted Effect probably benign
Transcript: ENSMUST00000209467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209626
Predicted Effect probably benign
Transcript: ENSMUST00000209711
Predicted Effect probably benign
Transcript: ENSMUST00000209812
Predicted Effect unknown
Transcript: ENSMUST00000209815
AA Change: M85K
Predicted Effect probably benign
Transcript: ENSMUST00000209838
Predicted Effect probably benign
Transcript: ENSMUST00000209927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210175
Predicted Effect probably benign
Transcript: ENSMUST00000210191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210792
Predicted Effect probably benign
Transcript: ENSMUST00000210818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210832
Predicted Effect probably benign
Transcript: ENSMUST00000210918
Predicted Effect probably benign
Transcript: ENSMUST00000210931
Predicted Effect probably benign
Transcript: ENSMUST00000210967
Predicted Effect probably benign
Transcript: ENSMUST00000211037
Predicted Effect probably benign
Transcript: ENSMUST00000211429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211583
Predicted Effect probably benign
Transcript: ENSMUST00000211725
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes lacking snoRNAs encoded by introns of this gene show altered mitochondrial metabolism, lower reactive oxygen species tone, enhanced glucose-stimulated insulin secretion and glucose tolerance, reduced oxidative stress responses in pancreatic islets, and resistance to diabetogenic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 K291N probably damaging Het
Adgra1 A G 7: 139,876,186 T577A probably damaging Het
Akip1 T A 7: 109,708,981 I152N possibly damaging Het
Armc9 A G 1: 86,202,518 Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 T724S probably damaging Het
Bmp1 C A 14: 70,492,844 R416L probably damaging Het
Bmt2 G T 6: 13,663,301 A66E probably benign Het
Bscl2 A T 19: 8,848,159 D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Cntnap4 A G 8: 112,785,836 Y610C probably damaging Het
Col11a2 T C 17: 34,064,293 probably null Het
Col17a1 T C 19: 47,663,058 probably null Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Dgkz T A 2: 91,938,346 K697* probably null Het
Dnah7b T A 1: 46,217,157 D1873E possibly damaging Het
Dst G A 1: 34,275,703 E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 N210S probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fbn2 T A 18: 58,040,193 N2051I possibly damaging Het
Gabrg2 G A 11: 41,968,823 H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 S167P probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
Gm281 A T 14: 13,856,724 D462E probably benign Het
Heatr5a T C 12: 51,877,347 N2028D probably benign Het
Heca T C 10: 17,915,309 H333R probably benign Het
Herc1 T C 9: 66,391,458 S625P probably damaging Het
Ighv1-55 T C 12: 115,208,555 probably benign Het
Ighv5-8 G A 12: 113,655,157 S64N probably benign Het
Itga1 G T 13: 115,001,691 probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 P118S possibly damaging Het
Lat2 T C 5: 134,606,057 N100S probably damaging Het
Lrit3 T A 3: 129,788,472 D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Med21 T A 6: 146,650,193 L114H probably damaging Het
Mfap4 A T 11: 61,485,510 probably benign Het
Mpdz G A 4: 81,383,812 R233W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Neto2 T G 8: 85,669,704 H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 I206V probably benign Het
Olfr472 A G 7: 107,903,360 I214M probably damaging Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 M61L probably damaging Het
Olfr577 A G 7: 102,973,806 M62T probably damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Olfr878 T C 9: 37,919,586 *310R probably null Het
Pcbp3 A G 10: 76,771,035 L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 probably benign Het
Podxl G A 6: 31,526,644 T254M possibly damaging Het
Prr27 A C 5: 87,843,241 E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 V84F probably damaging Het
Rnf26 A T 9: 44,112,131 D273E probably benign Het
Rpl3l A G 17: 24,733,610 K239E probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Ryk A G 9: 102,891,216 D352G possibly damaging Het
Setd1b T A 5: 123,160,998 probably benign Het
Sh2b1 G A 7: 126,471,446 A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 K92* probably null Het
Slc39a10 A G 1: 46,817,984 probably benign Het
Slc47a1 G A 11: 61,363,031 T194I probably benign Het
Slc6a3 C A 13: 73,544,817 N185K probably damaging Het
Stag1 T C 9: 100,848,705 V391A probably damaging Het
Syne2 A C 12: 75,949,301 N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 R481I possibly damaging Het
Tfam A G 10: 71,233,395 S166P probably benign Het
Tmem63a A G 1: 180,956,491 H212R probably benign Het
Txndc11 T A 16: 11,084,881 Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 probably benign Het
Vmn1r204 A T 13: 22,556,792 M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 T119S probably benign Het
Vsig1 A G X: 140,933,112 D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 P1102L probably benign Het
Zfp715 T C 7: 43,300,020 Q172R probably benign Het
Zfp872 A G 9: 22,197,405 D53G probably damaging Het
Zswim8 G A 14: 20,714,613 D684N probably benign Het
Other mutations in Rpl13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rpl13a APN 7 45127071 unclassified probably null
R1972:Rpl13a UTSW 7 45125995 nonsense probably null
R1973:Rpl13a UTSW 7 45125995 nonsense probably null
R4501:Rpl13a UTSW 7 45126140 missense probably benign 0.13
R4674:Rpl13a UTSW 7 45126818 unclassified probably benign
R5151:Rpl13a UTSW 7 45125961 missense probably benign 0.35
Z1088:Rpl13a UTSW 7 45127513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGCCAGTGGGGTTTTC -3'
(R):5'- GCATTTTCTGGCGCACTGTG -3'

Sequencing Primer
(F):5'- GGGTTTTCATGAGGCTCAAACAATG -3'
(R):5'- GCACTGTGCGAGGTGAG -3'
Posted On2015-10-08