Incidental Mutation 'R4675:Cntnap4'
ID349500
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Namecontactin associated protein-like 4
SynonymsE130114F09Rik, Caspr4
MMRRC Submission 041930-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4675 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location112570043-112882717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112785836 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 610 (Y610C)
Ref Sequence ENSEMBL: ENSMUSP00000112511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
Predicted Effect probably damaging
Transcript: ENSMUST00000034225
AA Change: Y610C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: Y610C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118171
AA Change: Y610C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: Y610C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140753
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 K291N probably damaging Het
Adgra1 A G 7: 139,876,186 T577A probably damaging Het
Akip1 T A 7: 109,708,981 I152N possibly damaging Het
Armc9 A G 1: 86,202,518 Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 T724S probably damaging Het
Bmp1 C A 14: 70,492,844 R416L probably damaging Het
Bmt2 G T 6: 13,663,301 A66E probably benign Het
Bscl2 A T 19: 8,848,159 D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Col11a2 T C 17: 34,064,293 probably null Het
Col17a1 T C 19: 47,663,058 probably null Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Dgkz T A 2: 91,938,346 K697* probably null Het
Dnah7b T A 1: 46,217,157 D1873E possibly damaging Het
Dst G A 1: 34,275,703 E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 N210S probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fbn2 T A 18: 58,040,193 N2051I possibly damaging Het
Gabrg2 G A 11: 41,968,823 H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 S167P probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
Gm281 A T 14: 13,856,724 D462E probably benign Het
Heatr5a T C 12: 51,877,347 N2028D probably benign Het
Heca T C 10: 17,915,309 H333R probably benign Het
Herc1 T C 9: 66,391,458 S625P probably damaging Het
Ighv1-55 T C 12: 115,208,555 probably benign Het
Ighv5-8 G A 12: 113,655,157 S64N probably benign Het
Itga1 G T 13: 115,001,691 probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 P118S possibly damaging Het
Lat2 T C 5: 134,606,057 N100S probably damaging Het
Lrit3 T A 3: 129,788,472 D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Med21 T A 6: 146,650,193 L114H probably damaging Het
Mfap4 A T 11: 61,485,510 probably benign Het
Mpdz G A 4: 81,383,812 R233W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Neto2 T G 8: 85,669,704 H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 I206V probably benign Het
Olfr472 A G 7: 107,903,360 I214M probably damaging Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 M61L probably damaging Het
Olfr577 A G 7: 102,973,806 M62T probably damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Olfr878 T C 9: 37,919,586 *310R probably null Het
Pcbp3 A G 10: 76,771,035 L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 probably benign Het
Podxl G A 6: 31,526,644 T254M possibly damaging Het
Prr27 A C 5: 87,843,241 E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 V84F probably damaging Het
Rnf26 A T 9: 44,112,131 D273E probably benign Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rpl3l A G 17: 24,733,610 K239E probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Ryk A G 9: 102,891,216 D352G possibly damaging Het
Setd1b T A 5: 123,160,998 probably benign Het
Sh2b1 G A 7: 126,471,446 A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 K92* probably null Het
Slc39a10 A G 1: 46,817,984 probably benign Het
Slc47a1 G A 11: 61,363,031 T194I probably benign Het
Slc6a3 C A 13: 73,544,817 N185K probably damaging Het
Stag1 T C 9: 100,848,705 V391A probably damaging Het
Syne2 A C 12: 75,949,301 N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 R481I possibly damaging Het
Tfam A G 10: 71,233,395 S166P probably benign Het
Tmem63a A G 1: 180,956,491 H212R probably benign Het
Txndc11 T A 16: 11,084,881 Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 probably benign Het
Vmn1r204 A T 13: 22,556,792 M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 T119S probably benign Het
Vsig1 A G X: 140,933,112 D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 P1102L probably benign Het
Zfp715 T C 7: 43,300,020 Q172R probably benign Het
Zfp872 A G 9: 22,197,405 D53G probably damaging Het
Zswim8 G A 14: 20,714,613 D684N probably benign Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 112767619 splice site probably benign
IGL01898:Cntnap4 APN 8 112856307 missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 112752234 missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 112616494 missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 112785903 splice site probably benign
IGL02621:Cntnap4 APN 8 112810723 missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 112773590 missense probably benign 0.06
IGL03327:Cntnap4 APN 8 112773576 missense probably benign 0.00
IGL03346:Cntnap4 APN 8 112773576 missense probably benign 0.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 112785784 missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 112842516 critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 112856511 nonsense probably null
R0497:Cntnap4 UTSW 8 112570151 missense probably benign 0.00
R1495:Cntnap4 UTSW 8 112881763 missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 112881830 missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 112757523 missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 112815496 missense probably benign 0.10
R2160:Cntnap4 UTSW 8 112757571 missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 112757439 missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R3917:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R4097:Cntnap4 UTSW 8 112752307 missense probably benign 0.03
R4348:Cntnap4 UTSW 8 112753922 missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 112665266 missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 112858210 missense probably benign 0.32
R4531:Cntnap4 UTSW 8 112810608 missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 112810710 missense probably benign
R4611:Cntnap4 UTSW 8 112773739 critical splice donor site probably null
R4801:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 112733438 missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 112841753 missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 112875429 missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 112842721 missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 112803211 missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 112752289 missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 112757473 missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 112803226 missense probably benign 0.03
R7031:Cntnap4 UTSW 8 112858242 missense probably benign 0.01
R7107:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 112810636 missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 112881800 missense probably benign 0.05
X0025:Cntnap4 UTSW 8 112859143 missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 112875579 missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 112815520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGATTAGCTCTGAAGGTTATGG -3'
(R):5'- CTACTTCAGTCATGTTGCAAATCAG -3'

Sequencing Primer
(F):5'- AAATATTACCTGTTCCCTTGGCCAG -3'
(R):5'- CAGTCATGTTGCAAATCAGATTGATG -3'
Posted On2015-10-08