Incidental Mutation 'R4675:Stag1'
ID349507
Institutional Source Beutler Lab
Gene Symbol Stag1
Ensembl Gene ENSMUSG00000037286
Gene Namestromal antigen 1
SynonymsScc3, SA-1
MMRRC Submission 041930-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4675 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100597798-100959375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100848705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 391 (V391A)
Ref Sequence ENSEMBL: ENSMUSP00000116205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000138405] [ENSMUST00000155108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041418
AA Change: V391A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286
AA Change: V391A

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-50 PFAM
SCOP:d1qbkb_ 279 850 4e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122824
Predicted Effect possibly damaging
Transcript: ENSMUST00000123302
AA Change: V391A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286
AA Change: V391A

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 2.9e-51 PFAM
low complexity region 303 315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129269
AA Change: V391A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286
AA Change: V391A

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 160 274 3.8e-41 PFAM
SCOP:d1qbkb_ 279 850 3e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138405
SMART Domains Protein: ENSMUSP00000116322
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143150
Predicted Effect probably damaging
Transcript: ENSMUST00000146934
AA Change: V37A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120974
Gene: ENSMUSG00000037286
AA Change: V37A

DomainStartEndE-ValueType
low complexity region 673 692 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149771
Predicted Effect probably benign
Transcript: ENSMUST00000155108
SMART Domains Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 K291N probably damaging Het
Adgra1 A G 7: 139,876,186 T577A probably damaging Het
Akip1 T A 7: 109,708,981 I152N possibly damaging Het
Armc9 A G 1: 86,202,518 Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 T724S probably damaging Het
Bmp1 C A 14: 70,492,844 R416L probably damaging Het
Bmt2 G T 6: 13,663,301 A66E probably benign Het
Bscl2 A T 19: 8,848,159 D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Cntnap4 A G 8: 112,785,836 Y610C probably damaging Het
Col11a2 T C 17: 34,064,293 probably null Het
Col17a1 T C 19: 47,663,058 probably null Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Dgkz T A 2: 91,938,346 K697* probably null Het
Dnah7b T A 1: 46,217,157 D1873E possibly damaging Het
Dst G A 1: 34,275,703 E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 N210S probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fbn2 T A 18: 58,040,193 N2051I possibly damaging Het
Gabrg2 G A 11: 41,968,823 H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 S167P probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
Gm281 A T 14: 13,856,724 D462E probably benign Het
Heatr5a T C 12: 51,877,347 N2028D probably benign Het
Heca T C 10: 17,915,309 H333R probably benign Het
Herc1 T C 9: 66,391,458 S625P probably damaging Het
Ighv1-55 T C 12: 115,208,555 probably benign Het
Ighv5-8 G A 12: 113,655,157 S64N probably benign Het
Itga1 G T 13: 115,001,691 probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 P118S possibly damaging Het
Lat2 T C 5: 134,606,057 N100S probably damaging Het
Lrit3 T A 3: 129,788,472 D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Med21 T A 6: 146,650,193 L114H probably damaging Het
Mfap4 A T 11: 61,485,510 probably benign Het
Mpdz G A 4: 81,383,812 R233W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Neto2 T G 8: 85,669,704 H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 I206V probably benign Het
Olfr472 A G 7: 107,903,360 I214M probably damaging Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 M61L probably damaging Het
Olfr577 A G 7: 102,973,806 M62T probably damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Olfr878 T C 9: 37,919,586 *310R probably null Het
Pcbp3 A G 10: 76,771,035 L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 probably benign Het
Podxl G A 6: 31,526,644 T254M possibly damaging Het
Prr27 A C 5: 87,843,241 E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 V84F probably damaging Het
Rnf26 A T 9: 44,112,131 D273E probably benign Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rpl3l A G 17: 24,733,610 K239E probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Ryk A G 9: 102,891,216 D352G possibly damaging Het
Setd1b T A 5: 123,160,998 probably benign Het
Sh2b1 G A 7: 126,471,446 A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 K92* probably null Het
Slc39a10 A G 1: 46,817,984 probably benign Het
Slc47a1 G A 11: 61,363,031 T194I probably benign Het
Slc6a3 C A 13: 73,544,817 N185K probably damaging Het
Syne2 A C 12: 75,949,301 N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 R481I possibly damaging Het
Tfam A G 10: 71,233,395 S166P probably benign Het
Tmem63a A G 1: 180,956,491 H212R probably benign Het
Txndc11 T A 16: 11,084,881 Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 probably benign Het
Vmn1r204 A T 13: 22,556,792 M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 T119S probably benign Het
Vsig1 A G X: 140,933,112 D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 P1102L probably benign Het
Zfp715 T C 7: 43,300,020 Q172R probably benign Het
Zfp872 A G 9: 22,197,405 D53G probably damaging Het
Zswim8 G A 14: 20,714,613 D684N probably benign Het
Other mutations in Stag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Stag1 APN 9 100776808 missense probably damaging 1.00
IGL01010:Stag1 APN 9 100945933 missense probably benign 0.06
IGL01012:Stag1 APN 9 100855859 missense possibly damaging 0.47
IGL01025:Stag1 APN 9 100951657 missense possibly damaging 0.95
IGL01307:Stag1 APN 9 100951788 intron probably benign
IGL02149:Stag1 APN 9 100887389 missense probably benign 0.09
IGL02608:Stag1 APN 9 100757769 missense probably null 0.99
IGL03008:Stag1 APN 9 100776791 missense probably damaging 1.00
IGL03210:Stag1 APN 9 100845076 missense possibly damaging 0.63
eto_o UTSW 9 100796716 missense probably damaging 1.00
PIT4280001:Stag1 UTSW 9 100942716 missense possibly damaging 0.95
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0349:Stag1 UTSW 9 100776784 missense probably damaging 0.98
R0479:Stag1 UTSW 9 100928091 missense probably benign 0.00
R0531:Stag1 UTSW 9 100954247 makesense probably null
R0962:Stag1 UTSW 9 100796827 missense probably damaging 1.00
R0976:Stag1 UTSW 9 100776824 missense probably damaging 0.98
R0976:Stag1 UTSW 9 100930016 critical splice donor site probably null
R1170:Stag1 UTSW 9 100888453 intron probably benign
R1499:Stag1 UTSW 9 100855832 missense possibly damaging 0.77
R1499:Stag1 UTSW 9 100887373 intron probably benign
R1644:Stag1 UTSW 9 100880900 intron probably benign
R1747:Stag1 UTSW 9 100888300 missense probably benign
R1799:Stag1 UTSW 9 100953462 intron probably null
R1807:Stag1 UTSW 9 100908666 missense probably benign 0.34
R1978:Stag1 UTSW 9 100888086 missense probably benign 0.03
R2029:Stag1 UTSW 9 100786687 missense probably damaging 1.00
R2161:Stag1 UTSW 9 100889595 missense probably damaging 1.00
R2300:Stag1 UTSW 9 100712500 missense possibly damaging 0.92
R2327:Stag1 UTSW 9 100786613 missense possibly damaging 0.81
R2426:Stag1 UTSW 9 100845116 critical splice donor site probably null
R2448:Stag1 UTSW 9 100888409 missense probably benign 0.42
R2504:Stag1 UTSW 9 100866210 missense probably damaging 0.99
R3713:Stag1 UTSW 9 100889618 missense probably benign 0.01
R3835:Stag1 UTSW 9 100737982 missense probably damaging 0.97
R3862:Stag1 UTSW 9 100944785 missense probably benign 0.02
R4398:Stag1 UTSW 9 100956606 utr 3 prime probably benign
R4568:Stag1 UTSW 9 100848669 missense probably damaging 1.00
R4651:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4652:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4653:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4709:Stag1 UTSW 9 100738039 missense probably damaging 0.99
R4924:Stag1 UTSW 9 100796755 missense possibly damaging 0.67
R5018:Stag1 UTSW 9 100951619 missense probably benign 0.00
R5435:Stag1 UTSW 9 100953550 missense probably benign 0.03
R5460:Stag1 UTSW 9 100956453 splice site probably null
R5805:Stag1 UTSW 9 100796778 missense probably damaging 1.00
R6127:Stag1 UTSW 9 100951697 missense probably benign 0.05
R6313:Stag1 UTSW 9 100757733 missense probably damaging 1.00
R6597:Stag1 UTSW 9 100887420 missense probably benign 0.01
R6807:Stag1 UTSW 9 100944850 missense probably damaging 1.00
R7099:Stag1 UTSW 9 100944826 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCCACTTAAATAAGATGGTTTCAAG -3'
(R):5'- GACTGCACAAACAAACTTTTATACG -3'

Sequencing Primer
(F):5'- GCTTTAATCCTGGCACTAGGGAAC -3'
(R):5'- CCGAACCTGGGCTTCATTATAAG -3'
Posted On2015-10-08