Incidental Mutation 'R4675:Fbn2'
ID349538
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 041930-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4675 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58040193 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 2051 (N2051I)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025497
AA Change: N2051I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: N2051I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 K291N probably damaging Het
Adgra1 A G 7: 139,876,186 T577A probably damaging Het
Akip1 T A 7: 109,708,981 I152N possibly damaging Het
Armc9 A G 1: 86,202,518 Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 T724S probably damaging Het
Bmp1 C A 14: 70,492,844 R416L probably damaging Het
Bmt2 G T 6: 13,663,301 A66E probably benign Het
Bscl2 A T 19: 8,848,159 D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Cntnap4 A G 8: 112,785,836 Y610C probably damaging Het
Col11a2 T C 17: 34,064,293 probably null Het
Col17a1 T C 19: 47,663,058 probably null Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Dgkz T A 2: 91,938,346 K697* probably null Het
Dnah7b T A 1: 46,217,157 D1873E possibly damaging Het
Dst G A 1: 34,275,703 E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 N210S probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Gabrg2 G A 11: 41,968,823 H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 S167P probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
Gm281 A T 14: 13,856,724 D462E probably benign Het
Heatr5a T C 12: 51,877,347 N2028D probably benign Het
Heca T C 10: 17,915,309 H333R probably benign Het
Herc1 T C 9: 66,391,458 S625P probably damaging Het
Ighv1-55 T C 12: 115,208,555 probably benign Het
Ighv5-8 G A 12: 113,655,157 S64N probably benign Het
Itga1 G T 13: 115,001,691 probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 P118S possibly damaging Het
Lat2 T C 5: 134,606,057 N100S probably damaging Het
Lrit3 T A 3: 129,788,472 D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Med21 T A 6: 146,650,193 L114H probably damaging Het
Mfap4 A T 11: 61,485,510 probably benign Het
Mpdz G A 4: 81,383,812 R233W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Neto2 T G 8: 85,669,704 H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 I206V probably benign Het
Olfr472 A G 7: 107,903,360 I214M probably damaging Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 M61L probably damaging Het
Olfr577 A G 7: 102,973,806 M62T probably damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Olfr878 T C 9: 37,919,586 *310R probably null Het
Pcbp3 A G 10: 76,771,035 L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 probably benign Het
Podxl G A 6: 31,526,644 T254M possibly damaging Het
Prr27 A C 5: 87,843,241 E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 V84F probably damaging Het
Rnf26 A T 9: 44,112,131 D273E probably benign Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rpl3l A G 17: 24,733,610 K239E probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Ryk A G 9: 102,891,216 D352G possibly damaging Het
Setd1b T A 5: 123,160,998 probably benign Het
Sh2b1 G A 7: 126,471,446 A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 K92* probably null Het
Slc39a10 A G 1: 46,817,984 probably benign Het
Slc47a1 G A 11: 61,363,031 T194I probably benign Het
Slc6a3 C A 13: 73,544,817 N185K probably damaging Het
Stag1 T C 9: 100,848,705 V391A probably damaging Het
Syne2 A C 12: 75,949,301 N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 R481I possibly damaging Het
Tfam A G 10: 71,233,395 S166P probably benign Het
Tmem63a A G 1: 180,956,491 H212R probably benign Het
Txndc11 T A 16: 11,084,881 Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 probably benign Het
Vmn1r204 A T 13: 22,556,792 M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 T119S probably benign Het
Vsig1 A G X: 140,933,112 D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 P1102L probably benign Het
Zfp715 T C 7: 43,300,020 Q172R probably benign Het
Zfp872 A G 9: 22,197,405 D53G probably damaging Het
Zswim8 G A 14: 20,714,613 D684N probably benign Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGATAAAGCCCTAGCCCAATG -3'
(R):5'- GAAACTCTGGCATGTGGCTG -3'

Sequencing Primer
(F):5'- TGATAAAGCCCTAGCCCAATGAAGAG -3'
(R):5'- GCTGGCTCAAATTGGATATGATC -3'
Posted On2015-10-08