Incidental Mutation 'R4676:Igsf10'
ID349551
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Nameimmunoglobulin superfamily, member 10
SynonymsAdlican2, CMF608, 6530405F15Rik
MMRRC Submission 042013-MU
Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R4676 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59316735-59344394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59325949 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 1788 (F1788V)
Ref Sequence ENSEMBL: ENSMUSP00000141391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]
Predicted Effect probably benign
Transcript: ENSMUST00000039419
AA Change: F1788V

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: F1788V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193455
AA Change: F1788V

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: F1788V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194546
AA Change: F1788V

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: F1788V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Ano10 T C 9: 122,263,787 R159G probably damaging Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atf6 T C 1: 170,787,410 Y538C probably damaging Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
BC067074 C A 13: 113,368,807 L2157I probably damaging Het
BC067074 T G 13: 113,368,808 L2157R probably damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Bnc2 T C 4: 84,292,819 N463D probably damaging Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Nr1h4 T C 10: 89,473,874 D317G probably damaging Het
Olfr1497 T A 19: 13,795,474 I46F possibly damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Pde5a A T 3: 122,747,893 M11L possibly damaging Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59331539 missense probably benign 0.03
IGL00790:Igsf10 APN 3 59319517 missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59331127 missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59330597 missense probably benign 0.00
IGL01066:Igsf10 APN 3 59327782 critical splice donor site probably null
IGL01107:Igsf10 APN 3 59331524 missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59319650 missense probably benign 0.02
IGL01533:Igsf10 APN 3 59319230 missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59330031 missense probably benign 0.00
IGL01676:Igsf10 APN 3 59326011 missense probably benign 0.06
IGL01676:Igsf10 APN 3 59329335 missense probably benign 0.17
IGL01960:Igsf10 APN 3 59318737 missense probably benign 0.00
IGL02123:Igsf10 APN 3 59318660 missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59325978 missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59331152 nonsense probably null
IGL02313:Igsf10 APN 3 59330690 missense probably benign 0.01
IGL02368:Igsf10 APN 3 59328231 missense probably benign
IGL02494:Igsf10 APN 3 59328006 missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59329241 missense probably benign 0.03
IGL02616:Igsf10 APN 3 59318606 missense probably benign 0.06
IGL02957:Igsf10 APN 3 59330864 missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59318918 missense probably benign 0.25
IGL03104:Igsf10 APN 3 59319484 missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59319665 missense probably benign 0.01
IGL03212:Igsf10 APN 3 59328165 missense probably benign 0.09
IGL03347:Igsf10 APN 3 59331900 missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59336211 missense probably benign 0.35
F6893:Igsf10 UTSW 3 59331060 missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59319110 missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59328158 missense probably benign 0.06
R0068:Igsf10 UTSW 3 59330624 missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0112:Igsf10 UTSW 3 59326008 missense probably benign 0.00
R0141:Igsf10 UTSW 3 59330832 missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59320106 missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59328668 missense probably benign 0.01
R0556:Igsf10 UTSW 3 59328875 missense probably benign 0.02
R0582:Igsf10 UTSW 3 59319767 missense probably benign 0.00
R0630:Igsf10 UTSW 3 59326062 missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59328594 missense probably benign 0.14
R0948:Igsf10 UTSW 3 59331104 missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59331848 missense probably benign 0.03
R1412:Igsf10 UTSW 3 59327775 splice site probably benign
R1473:Igsf10 UTSW 3 59318767 missense probably damaging 1.00
R1585:Igsf10 UTSW 3 59330417 missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59326162 missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59331285 missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59328500 nonsense probably null
R1748:Igsf10 UTSW 3 59319093 missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59329196 missense probably benign 0.09
R1856:Igsf10 UTSW 3 59331272 missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59329572 missense probably benign 0.40
R2148:Igsf10 UTSW 3 59336577 missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59331680 missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59325454 missense probably benign 0.14
R2913:Igsf10 UTSW 3 59331736 missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59329427 missense probably benign
R3547:Igsf10 UTSW 3 59330541 missense probably benign 0.02
R3547:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3548:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59336331 missense probably damaging 1.00
R3732:Igsf10 UTSW 3 59325714 missense probably benign 0.29
R3743:Igsf10 UTSW 3 59326125 missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59331924 missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59328560 missense probably benign 0.00
R4184:Igsf10 UTSW 3 59319731 missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59318750 missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59329551 missense probably benign 0.04
R4575:Igsf10 UTSW 3 59330100 missense probably benign
R4700:Igsf10 UTSW 3 59320330 missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59329705 missense probably benign 0.01
R4986:Igsf10 UTSW 3 59328606 missense probably benign 0.24
R5012:Igsf10 UTSW 3 59318722 missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59328293 missense probably benign 0.02
R5083:Igsf10 UTSW 3 59326273 missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59320132 missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59325754 missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59328153 missense probably benign 0.01
R5810:Igsf10 UTSW 3 59319071 missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59330411 missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59330831 missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59328157 missense probably benign 0.12
R5979:Igsf10 UTSW 3 59336473 missense probably damaging 1.00
R6145:Igsf10 UTSW 3 59331656 missense possibly damaging 0.83
R6222:Igsf10 UTSW 3 59318915 missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59325510 missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59328507 missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59319449 missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59330339 missense probably benign 0.00
R6490:Igsf10 UTSW 3 59329571 missense probably benign 0.06
R6785:Igsf10 UTSW 3 59319244 missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59328444 missense probably benign
R6889:Igsf10 UTSW 3 59331933 missense probably benign
Z1088:Igsf10 UTSW 3 59329938 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCAGTGGTTTTAGTTCAGTCCC -3'
(R):5'- GATCACAGCTCATTCCGGAAG -3'

Sequencing Primer
(F):5'- TTAGTTCAGTCCCATCATAGAGGACC -3'
(R):5'- AGCTCATTCCGGAAGTACTG -3'
Posted On2015-10-08