Incidental Mutation 'R4676:Bnc2'
ID349558
Institutional Source Beutler Lab
Gene Symbol Bnc2
Ensembl Gene ENSMUSG00000028487
Gene Namebasonuclin 2
Synonyms
MMRRC Submission 042013-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4676 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location84275095-84675275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84292819 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 463 (N463D)
Ref Sequence ENSEMBL: ENSMUSP00000135778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102820] [ENSMUST00000107198] [ENSMUST00000175800] [ENSMUST00000175969] [ENSMUST00000176418] [ENSMUST00000176601] [ENSMUST00000176612] [ENSMUST00000176691] [ENSMUST00000176947] [ENSMUST00000176971] [ENSMUST00000176998]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102820
AA Change: N533D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099884
Gene: ENSMUSG00000028487
AA Change: N533D

DomainStartEndE-ValueType
low complexity region 362 378 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 469 492 4.72e-2 SMART
ZnF_C2H2 497 526 7.11e0 SMART
low complexity region 612 629 N/A INTRINSIC
low complexity region 633 642 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
ZnF_C2H2 861 884 1.62e0 SMART
ZnF_C2H2 889 916 4.81e0 SMART
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1048 1062 N/A INTRINSIC
ZnF_C2H2 1063 1086 1.03e-2 SMART
ZnF_C2H2 1091 1118 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107198
AA Change: N505D

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102816
Gene: ENSMUSG00000028487
AA Change: N505D

DomainStartEndE-ValueType
low complexity region 334 350 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
ZnF_C2H2 441 464 4.72e-2 SMART
ZnF_C2H2 469 498 7.11e0 SMART
low complexity region 584 601 N/A INTRINSIC
low complexity region 605 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
ZnF_C2H2 833 856 1.62e0 SMART
ZnF_C2H2 861 888 4.81e0 SMART
low complexity region 963 980 N/A INTRINSIC
low complexity region 1020 1034 N/A INTRINSIC
ZnF_C2H2 1035 1058 1.03e-2 SMART
ZnF_C2H2 1063 1090 3.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175757
Predicted Effect probably benign
Transcript: ENSMUST00000175800
SMART Domains Protein: ENSMUSP00000134795
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 256 272 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175969
Predicted Effect probably benign
Transcript: ENSMUST00000176418
SMART Domains Protein: ENSMUSP00000135569
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 367 383 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176476
Predicted Effect probably benign
Transcript: ENSMUST00000176601
SMART Domains Protein: ENSMUSP00000135480
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.62e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176612
AA Change: N463D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135778
Gene: ENSMUSG00000028487
AA Change: N463D

DomainStartEndE-ValueType
low complexity region 292 308 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
ZnF_C2H2 399 422 4.72e-2 SMART
ZnF_C2H2 427 456 7.11e0 SMART
low complexity region 542 559 N/A INTRINSIC
low complexity region 563 572 N/A INTRINSIC
low complexity region 606 620 N/A INTRINSIC
ZnF_C2H2 791 814 1.62e0 SMART
low complexity region 832 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176691
AA Change: N438D

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135375
Gene: ENSMUSG00000028487
AA Change: N438D

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 374 397 4.72e-2 SMART
ZnF_C2H2 402 431 7.11e0 SMART
low complexity region 517 534 N/A INTRINSIC
low complexity region 538 547 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
ZnF_C2H2 766 789 1.62e0 SMART
ZnF_C2H2 794 821 4.81e0 SMART
low complexity region 896 913 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
ZnF_C2H2 968 991 1.03e-2 SMART
ZnF_C2H2 996 1023 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176702
SMART Domains Protein: ENSMUSP00000134774
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 105 128 1.62e0 SMART
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176947
Predicted Effect probably benign
Transcript: ENSMUST00000176971
SMART Domains Protein: ENSMUSP00000135607
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 3 28 1.98e2 SMART
low complexity region 103 120 N/A INTRINSIC
low complexity region 160 174 N/A INTRINSIC
ZnF_C2H2 175 198 1.03e-2 SMART
ZnF_C2H2 203 230 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176998
SMART Domains Protein: ENSMUSP00000135283
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.62e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177277
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved zinc finger protein. The encoded protein functions in skin color saturation. Mutations in this gene are associated with facial pigmented spots. This gene is also associated with susceptibility to adolescent idiopathic scoliosis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap insertion die within 24 hrs of birth and display cleft palate, an overall size reduction of the head and tongue, and abnormal craniofacial bone development due to impaired multiplication of embryonic craniofacial mesenchymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Ano10 T C 9: 122,263,787 R159G probably damaging Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atf6 T C 1: 170,787,410 Y538C probably damaging Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
BC067074 C A 13: 113,368,807 L2157I probably damaging Het
BC067074 T G 13: 113,368,808 L2157R probably damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Igsf10 A C 3: 59,325,949 F1788V probably benign Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Nr1h4 T C 10: 89,473,874 D317G probably damaging Het
Olfr1497 T A 19: 13,795,474 I46F possibly damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Pde5a A T 3: 122,747,893 M11L possibly damaging Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in Bnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Bnc2 APN 4 84276241 unclassified probably null
IGL01902:Bnc2 APN 4 84390944 missense probably damaging 1.00
IGL02228:Bnc2 APN 4 84293076 missense possibly damaging 0.70
IGL02396:Bnc2 APN 4 84276009 missense probably benign 0.16
R0125:Bnc2 UTSW 4 84292932 missense probably damaging 1.00
R0650:Bnc2 UTSW 4 84293196 missense probably benign 0.04
R1082:Bnc2 UTSW 4 84546335 missense probably damaging 1.00
R1334:Bnc2 UTSW 4 84276289 missense possibly damaging 0.49
R1439:Bnc2 UTSW 4 84276068 missense probably benign 0.38
R1447:Bnc2 UTSW 4 84293220 missense probably benign 0.13
R1515:Bnc2 UTSW 4 84414326 missense probably null 0.99
R1548:Bnc2 UTSW 4 84275957 missense probably damaging 1.00
R1818:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R1819:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R2345:Bnc2 UTSW 4 84292503 missense probably damaging 1.00
R2897:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2898:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2966:Bnc2 UTSW 4 84293517 missense probably benign 0.14
R3404:Bnc2 UTSW 4 84546241 missense probably damaging 0.98
R4235:Bnc2 UTSW 4 84293514 missense probably damaging 0.96
R4546:Bnc2 UTSW 4 84291976 missense probably benign 0.34
R4926:Bnc2 UTSW 4 84276179 missense probably damaging 1.00
R5060:Bnc2 UTSW 4 84531635 missense probably benign 0.02
R5365:Bnc2 UTSW 4 84411429 intron probably benign
R5735:Bnc2 UTSW 4 84292671 missense probably damaging 1.00
R5872:Bnc2 UTSW 4 84292770 missense possibly damaging 0.86
R5921:Bnc2 UTSW 4 84293055 missense possibly damaging 0.95
R5999:Bnc2 UTSW 4 84555900 missense probably benign 0.20
R6351:Bnc2 UTSW 4 84293143 missense probably benign 0.16
R6869:Bnc2 UTSW 4 84293496 missense probably damaging 1.00
X0021:Bnc2 UTSW 4 84293140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTACAGTCTTTAGCCC -3'
(R):5'- CCTCCAGGAAAGGAAGGGTATTC -3'

Sequencing Primer
(F):5'- CCAGAAAATACCAGCTGGCTTGG -3'
(R):5'- AAAGGAAGGGTATTCTGTAATGCTTG -3'
Posted On2015-10-08