Incidental Mutation 'R4676:BC067074'
ID349597
Institutional Source Beutler Lab
Gene Symbol BC067074
Ensembl Gene ENSMUSG00000021763
Gene NamecDNA sequence BC067074
Synonyms
MMRRC Submission 042013-MU
Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R4676 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113293159-113379711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 113368808 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 2157 (L2157R)
Ref Sequence ENSEMBL: ENSMUSP00000119993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078163] [ENSMUST00000136755]
Predicted Effect probably damaging
Transcript: ENSMUST00000078163
AA Change: L615R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077297
Gene: ENSMUSG00000021763
AA Change: L615R

DomainStartEndE-ValueType
Pfam:Cadherin_3 29 136 4.6e-12 PFAM
low complexity region 190 198 N/A INTRINSIC
Pfam:Cadherin_3 231 384 4.9e-38 PFAM
transmembrane domain 725 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135096
SMART Domains Protein: ENSMUSP00000131959
Gene: ENSMUSG00000021763

DomainStartEndE-ValueType
Pfam:Cadherin_3 1 86 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136755
AA Change: L2157R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: L2157R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LamG 44 177 1.28e-20 SMART
LamG 229 371 4.66e-14 SMART
low complexity region 407 420 N/A INTRINSIC
Pfam:Cadherin_3 492 644 2.1e-35 PFAM
Pfam:Cadherin_3 647 759 1e-7 PFAM
Pfam:Cadherin_3 741 873 1.2e-8 PFAM
Pfam:Cadherin_3 861 989 4.1e-14 PFAM
Pfam:Cadherin_3 958 1114 1.2e-20 PFAM
Pfam:Cadherin_3 1117 1223 1.6e-10 PFAM
Pfam:Cadherin_3 1212 1341 5.6e-12 PFAM
Pfam:Cadherin_3 1347 1438 3.8e-8 PFAM
Pfam:Cadherin_3 1419 1562 2.3e-45 PFAM
Pfam:Cadherin_3 1576 1679 2.1e-9 PFAM
low complexity region 1732 1740 N/A INTRINSIC
Pfam:Cadherin_3 1773 1926 3e-35 PFAM
transmembrane domain 2267 2289 N/A INTRINSIC
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Ano10 T C 9: 122,263,787 R159G probably damaging Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atf6 T C 1: 170,787,410 Y538C probably damaging Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Bnc2 T C 4: 84,292,819 N463D probably damaging Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Igsf10 A C 3: 59,325,949 F1788V probably benign Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Nr1h4 T C 10: 89,473,874 D317G probably damaging Het
Olfr1497 T A 19: 13,795,474 I46F possibly damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Pde5a A T 3: 122,747,893 M11L possibly damaging Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in BC067074
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:BC067074 APN 13 113367557 missense possibly damaging 0.91
IGL03023:BC067074 APN 13 113351741 missense probably benign 0.03
cumpleanos UTSW 13 113368336 missense possibly damaging 0.87
sorpresa UTSW 13 113318191 missense probably damaging 1.00
P0018:BC067074 UTSW 13 113367506 missense possibly damaging 0.60
R0003:BC067074 UTSW 13 113368776 missense probably benign 0.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0158:BC067074 UTSW 13 113369153 nonsense probably null
R0281:BC067074 UTSW 13 113369143 missense probably damaging 1.00
R1212:BC067074 UTSW 13 113369417 intron probably benign
R1300:BC067074 UTSW 13 113366160 missense probably damaging 1.00
R1434:BC067074 UTSW 13 113368492 missense possibly damaging 0.46
R1509:BC067074 UTSW 13 113368256 missense probably damaging 0.99
R1738:BC067074 UTSW 13 113367500 missense possibly damaging 0.69
R1758:BC067074 UTSW 13 113368732 missense possibly damaging 0.78
R1828:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R2061:BC067074 UTSW 13 113318094 missense probably damaging 0.99
R2570:BC067074 UTSW 13 113318587 missense probably benign 0.34
R2884:BC067074 UTSW 13 113320682 missense probably damaging 1.00
R2884:BC067074 UTSW 13 113369191 missense probably benign 0.00
R3004:BC067074 UTSW 13 113366154 missense probably damaging 1.00
R3150:BC067074 UTSW 13 113351760 missense probably damaging 1.00
R3773:BC067074 UTSW 13 113318209 missense probably benign 0.12
R3864:BC067074 UTSW 13 113322951 missense possibly damaging 0.64
R3971:BC067074 UTSW 13 113317126 missense probably damaging 1.00
R4004:BC067074 UTSW 13 113318380 missense probably benign 0.00
R4271:BC067074 UTSW 13 113342370 missense possibly damaging 0.76
R4382:BC067074 UTSW 13 113322754 missense probably benign 0.10
R4484:BC067074 UTSW 13 113319199 missense probably damaging 0.98
R4570:BC067074 UTSW 13 113318191 missense probably damaging 1.00
R4600:BC067074 UTSW 13 113319249 missense possibly damaging 0.95
R4622:BC067074 UTSW 13 113320081 missense probably benign 0.00
R4676:BC067074 UTSW 13 113368807 missense probably damaging 0.98
R4677:BC067074 UTSW 13 113379486 missense unknown
R4775:BC067074 UTSW 13 113317695 missense possibly damaging 0.91
R4779:BC067074 UTSW 13 113368336 missense possibly damaging 0.87
R4780:BC067074 UTSW 13 113317858 missense probably damaging 1.00
R4829:BC067074 UTSW 13 113368162 missense probably benign 0.05
R4841:BC067074 UTSW 13 113366190 missense probably benign 0.00
R4879:BC067074 UTSW 13 113319787 missense probably benign 0.03
R4930:BC067074 UTSW 13 113327662 missense probably damaging 1.00
R4934:BC067074 UTSW 13 113368348 missense probably damaging 1.00
R4987:BC067074 UTSW 13 113318101 missense probably benign 0.07
R5065:BC067074 UTSW 13 113320919 missense probably benign 0.01
R5216:BC067074 UTSW 13 113342413 missense probably benign 0.20
R5236:BC067074 UTSW 13 113366220 missense probably benign 0.14
R5247:BC067074 UTSW 13 113319459 missense probably damaging 1.00
R5250:BC067074 UTSW 13 113319771 missense possibly damaging 0.95
R5337:BC067074 UTSW 13 113318765 missense probably damaging 1.00
R5342:BC067074 UTSW 13 113366269 critical splice donor site probably null
R5426:BC067074 UTSW 13 113369053 missense probably benign 0.01
R5472:BC067074 UTSW 13 113319169 missense probably benign 0.12
R5526:BC067074 UTSW 13 113367893 missense probably benign 0.22
R5543:BC067074 UTSW 13 113320873 missense probably damaging 0.96
R5589:BC067074 UTSW 13 113317950 missense possibly damaging 0.95
R5623:BC067074 UTSW 13 113346634 missense possibly damaging 0.95
R5668:BC067074 UTSW 13 113317167 missense possibly damaging 0.55
R5793:BC067074 UTSW 13 113321022 missense possibly damaging 0.75
R5824:BC067074 UTSW 13 113368620 missense probably damaging 1.00
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6053:BC067074 UTSW 13 113320726 missense possibly damaging 0.51
R6125:BC067074 UTSW 13 113317683 missense probably benign 0.00
R6129:BC067074 UTSW 13 113368806 nonsense probably null
R6290:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6291:BC067074 UTSW 13 113320447 missense possibly damaging 0.85
R6302:BC067074 UTSW 13 113368112 missense probably damaging 1.00
R6317:BC067074 UTSW 13 113368268 missense probably benign 0.09
R6395:BC067074 UTSW 13 113369469 missense probably damaging 1.00
R6673:BC067074 UTSW 13 113367832 nonsense probably null
R6783:BC067074 UTSW 13 113320209 nonsense probably null
R6800:BC067074 UTSW 13 113368152 missense probably benign 0.02
R6857:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6889:BC067074 UTSW 13 113318378 missense probably damaging 0.99
R6934:BC067074 UTSW 13 113369266 missense probably benign
R7019:BC067074 UTSW 13 113351750 missense probably benign 0.01
R7100:BC067074 UTSW 13 113318967 missense
R7115:BC067074 UTSW 13 113320776 missense
R7152:BC067074 UTSW 13 113318850 missense
Predicted Primers PCR Primer
(F):5'- GTGATACAACCCCTAGTCCATGG -3'
(R):5'- CTGAGTTGACCCCAGGAATC -3'

Sequencing Primer
(F):5'- CTCGTTCGAAGAGCAGTTGATAGC -3'
(R):5'- GGAATCTGTCCCCTGCCATCTG -3'
Posted On2015-10-08