Incidental Mutation 'R4677:Lama5'
ID349638
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 042014-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4677 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 180179366 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 3134 (H3134Q)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
PDB Structure
LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015791
AA Change: H3134Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: H3134Q

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (85/85)
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,404 C402S probably damaging Het
Adamts9 T C 6: 92,816,606 M1T probably null Het
Akap3 T C 6: 126,865,263 S282P probably damaging Het
Anxa10 A G 8: 62,063,020 I206T probably damaging Het
Apobec3 A G 15: 79,895,512 D52G probably damaging Het
Arl6 A T 16: 59,618,865 probably null Het
BC067074 A G 13: 113,379,486 T145A unknown Het
Calcoco1 T C 15: 102,717,894 E87G probably damaging Het
Ccdc88b C A 19: 6,848,268 A1206S probably damaging Het
Ccpg1 A G 9: 73,015,915 probably benign Het
Cdon A G 9: 35,478,605 N852D probably damaging Het
Cobl T A 11: 12,386,665 Q41L possibly damaging Het
Dcdc2b T C 4: 129,614,143 T39A probably damaging Het
Ddx55 A T 5: 124,567,934 D474V probably benign Het
Dnah17 A G 11: 118,119,814 L521P probably damaging Het
Exoc1 A G 5: 76,559,163 D497G probably null Het
Fam151a A G 4: 106,748,259 E606G possibly damaging Het
Fbxw11 T A 11: 32,742,535 L502* probably null Het
Fcrl1 A G 3: 87,390,256 S337G possibly damaging Het
G6pc C A 11: 101,376,613 F296L probably benign Het
Gm17472 C A 6: 42,980,875 T26N probably damaging Het
Gm9573 T A 17: 35,619,707 probably benign Het
Grin2b A G 6: 135,774,872 V564A probably benign Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hhip A G 8: 80,045,097 Y195H probably damaging Het
Igkc A T 6: 70,726,678 probably benign Het
Islr A T 9: 58,157,359 D288E probably damaging Het
Kdelr1 A G 7: 45,873,773 S36G probably benign Het
Lor A G 3: 92,081,743 Y79H unknown Het
Lrp1b A G 2: 40,801,484 F3327S probably damaging Het
Lrrc41 C T 4: 116,095,135 H637Y probably benign Het
Map2k6 C T 11: 110,399,394 probably benign Het
Mcm3ap T G 10: 76,470,570 F172L probably damaging Het
Muc19 G A 15: 91,888,217 noncoding transcript Het
Muc6 T A 7: 141,639,790 probably benign Het
Nek1 A T 8: 61,028,806 I252L probably damaging Het
Nrg2 A T 18: 36,021,099 H588Q possibly damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Olfr1030 A G 2: 85,983,971 T44A possibly damaging Het
Olfr1046 A T 2: 86,217,688 S7R probably benign Het
Olfr340 A G 2: 36,453,050 N155S probably benign Het
Olfr64 T C 7: 103,893,408 E109G probably damaging Het
Pde3a A G 6: 141,466,139 N480D probably benign Het
Pde6c A G 19: 38,157,385 K374E probably damaging Het
Pdhx G A 2: 103,073,466 probably null Het
Pi4ka A G 16: 17,282,373 Y1888H probably damaging Het
Pnpla2 T A 7: 141,458,443 M203K probably damaging Het
Prrc2c C T 1: 162,705,179 probably benign Het
Ptcd3 G T 6: 71,893,514 H321N probably benign Het
Ptprt A G 2: 161,901,446 probably null Het
Ptx4 A G 17: 25,123,126 T192A probably benign Het
Qars A G 9: 108,509,690 probably benign Het
Ralgapa2 G A 2: 146,345,467 P1372S possibly damaging Het
Rps6ka4 G T 19: 6,839,486 T107K probably damaging Het
Rsf1 A G 7: 97,680,773 T1169A possibly damaging Het
Ryr2 C A 13: 11,706,667 W2626L probably damaging Het
Scn4a C T 11: 106,323,962 V1270I probably damaging Het
Serpinb9b T C 13: 33,039,823 S333P probably damaging Het
Sned1 A G 1: 93,296,297 probably benign Het
Sult1c2 C T 17: 53,830,109 V262M possibly damaging Het
Tll1 A T 8: 64,051,377 F662I probably benign Het
Tmem161a A T 8: 70,180,947 probably null Het
Top1mt A C 15: 75,664,058 V465G possibly damaging Het
Trcg1 A G 9: 57,245,861 K596E possibly damaging Het
Trim27 T A 13: 21,180,916 probably null Het
Trpm3 A G 19: 22,987,388 I1406V possibly damaging Het
Tssc4 T A 7: 143,070,509 S254T probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Usp30 A G 5: 114,119,644 T288A probably damaging Het
Usp48 C A 4: 137,616,381 R441S probably benign Het
Vmn1r29 T C 6: 58,307,300 S2P probably benign Het
Vmn2r65 T A 7: 84,963,874 I46L possibly damaging Het
Zeb1 A T 18: 5,766,775 I429F probably damaging Het
Zfp943 A G 17: 21,993,195 R421G probably benign Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CCTACAGGCCTAGACTGTTG -3'
(R):5'- CTGATGCCTACTACTTGGGAG -3'

Sequencing Primer
(F):5'- CTAGACTGTTGGCTGCAGCAG -3'
(R):5'- TGAACAGCTGCCCTTGAG -3'
Posted On2015-10-08