Incidental Mutation 'R4677:Exoc1'
ID349645
Institutional Source Beutler Lab
Gene Symbol Exoc1
Ensembl Gene ENSMUSG00000036435
Gene Nameexocyst complex component 1
Synonyms2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1
MMRRC Submission 042014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4677 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76529311-76570294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76559163 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 497 (D497G)
Ref Sequence ENSEMBL: ENSMUSP00000046719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493] [ENSMUST00000134521]
Predicted Effect probably null
Transcript: ENSMUST00000049469
AA Change: D497G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: D497G

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 856 5.5e-221 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087133
AA Change: D512G

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: D512G

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 871 2e-220 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113493
AA Change: D519G

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: D519G

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
coiled coil region 161 183 N/A INTRINSIC
Pfam:Sec3_C 190 878 4.1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132807
Predicted Effect probably benign
Transcript: ENSMUST00000134521
SMART Domains Protein: ENSMUSP00000121784
Gene: ENSMUSG00000036435

DomainStartEndE-ValueType
Pfam:Sec3_C 1 111 1.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202151
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,404 C402S probably damaging Het
Adamts9 T C 6: 92,816,606 M1T probably null Het
Akap3 T C 6: 126,865,263 S282P probably damaging Het
Anxa10 A G 8: 62,063,020 I206T probably damaging Het
Apobec3 A G 15: 79,895,512 D52G probably damaging Het
Arl6 A T 16: 59,618,865 probably null Het
BC067074 A G 13: 113,379,486 T145A unknown Het
Calcoco1 T C 15: 102,717,894 E87G probably damaging Het
Ccdc88b C A 19: 6,848,268 A1206S probably damaging Het
Ccpg1 A G 9: 73,015,915 probably benign Het
Cdon A G 9: 35,478,605 N852D probably damaging Het
Cobl T A 11: 12,386,665 Q41L possibly damaging Het
Dcdc2b T C 4: 129,614,143 T39A probably damaging Het
Ddx55 A T 5: 124,567,934 D474V probably benign Het
Dnah17 A G 11: 118,119,814 L521P probably damaging Het
Fam151a A G 4: 106,748,259 E606G possibly damaging Het
Fbxw11 T A 11: 32,742,535 L502* probably null Het
Fcrl1 A G 3: 87,390,256 S337G possibly damaging Het
G6pc C A 11: 101,376,613 F296L probably benign Het
Gm17472 C A 6: 42,980,875 T26N probably damaging Het
Gm9573 T A 17: 35,619,707 probably benign Het
Grin2b A G 6: 135,774,872 V564A probably benign Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hhip A G 8: 80,045,097 Y195H probably damaging Het
Igkc A T 6: 70,726,678 probably benign Het
Islr A T 9: 58,157,359 D288E probably damaging Het
Kdelr1 A G 7: 45,873,773 S36G probably benign Het
Lama5 G T 2: 180,179,366 H3134Q possibly damaging Het
Lor A G 3: 92,081,743 Y79H unknown Het
Lrp1b A G 2: 40,801,484 F3327S probably damaging Het
Lrrc41 C T 4: 116,095,135 H637Y probably benign Het
Map2k6 C T 11: 110,399,394 probably benign Het
Mcm3ap T G 10: 76,470,570 F172L probably damaging Het
Muc19 G A 15: 91,888,217 noncoding transcript Het
Muc6 T A 7: 141,639,790 probably benign Het
Nek1 A T 8: 61,028,806 I252L probably damaging Het
Nrg2 A T 18: 36,021,099 H588Q possibly damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Olfr1030 A G 2: 85,983,971 T44A possibly damaging Het
Olfr1046 A T 2: 86,217,688 S7R probably benign Het
Olfr340 A G 2: 36,453,050 N155S probably benign Het
Olfr64 T C 7: 103,893,408 E109G probably damaging Het
Pde3a A G 6: 141,466,139 N480D probably benign Het
Pde6c A G 19: 38,157,385 K374E probably damaging Het
Pdhx G A 2: 103,073,466 probably null Het
Pi4ka A G 16: 17,282,373 Y1888H probably damaging Het
Pnpla2 T A 7: 141,458,443 M203K probably damaging Het
Prrc2c C T 1: 162,705,179 probably benign Het
Ptcd3 G T 6: 71,893,514 H321N probably benign Het
Ptprt A G 2: 161,901,446 probably null Het
Ptx4 A G 17: 25,123,126 T192A probably benign Het
Qars A G 9: 108,509,690 probably benign Het
Ralgapa2 G A 2: 146,345,467 P1372S possibly damaging Het
Rps6ka4 G T 19: 6,839,486 T107K probably damaging Het
Rsf1 A G 7: 97,680,773 T1169A possibly damaging Het
Ryr2 C A 13: 11,706,667 W2626L probably damaging Het
Scn4a C T 11: 106,323,962 V1270I probably damaging Het
Serpinb9b T C 13: 33,039,823 S333P probably damaging Het
Sned1 A G 1: 93,296,297 probably benign Het
Sult1c2 C T 17: 53,830,109 V262M possibly damaging Het
Tll1 A T 8: 64,051,377 F662I probably benign Het
Tmem161a A T 8: 70,180,947 probably null Het
Top1mt A C 15: 75,664,058 V465G possibly damaging Het
Trcg1 A G 9: 57,245,861 K596E possibly damaging Het
Trim27 T A 13: 21,180,916 probably null Het
Trpm3 A G 19: 22,987,388 I1406V possibly damaging Het
Tssc4 T A 7: 143,070,509 S254T probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Usp30 A G 5: 114,119,644 T288A probably damaging Het
Usp48 C A 4: 137,616,381 R441S probably benign Het
Vmn1r29 T C 6: 58,307,300 S2P probably benign Het
Vmn2r65 T A 7: 84,963,874 I46L possibly damaging Het
Zeb1 A T 18: 5,766,775 I429F probably damaging Het
Zfp943 A G 17: 21,993,195 R421G probably benign Het
Other mutations in Exoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Exoc1 APN 5 76567023 missense possibly damaging 0.88
IGL01149:Exoc1 APN 5 76542244 splice site probably benign
IGL02061:Exoc1 APN 5 76542120 missense probably damaging 0.96
IGL02288:Exoc1 APN 5 76545313 missense probably benign
IGL02407:Exoc1 APN 5 76545346 missense probably damaging 0.97
IGL03089:Exoc1 APN 5 76542158 missense possibly damaging 0.81
IGL03242:Exoc1 APN 5 76559007 missense probably damaging 1.00
IGL03348:Exoc1 APN 5 76535593 missense probably damaging 1.00
IGL03411:Exoc1 APN 5 76542195 missense probably damaging 1.00
Smalls UTSW 5 76537779 missense probably damaging 1.00
R0462:Exoc1 UTSW 5 76543617 missense probably benign 0.37
R1216:Exoc1 UTSW 5 76554188 missense probably benign
R1528:Exoc1 UTSW 5 76549564 missense possibly damaging 0.94
R1531:Exoc1 UTSW 5 76559164 missense probably damaging 0.98
R1636:Exoc1 UTSW 5 76568118 missense probably benign 0.03
R1754:Exoc1 UTSW 5 76560322 unclassified probably null
R1803:Exoc1 UTSW 5 76561441 missense probably benign 0.18
R2086:Exoc1 UTSW 5 76532846 nonsense probably null
R2239:Exoc1 UTSW 5 76559710 unclassified probably benign
R3914:Exoc1 UTSW 5 76543561 missense possibly damaging 0.54
R4022:Exoc1 UTSW 5 76549570 missense possibly damaging 0.92
R4329:Exoc1 UTSW 5 76567975 missense probably damaging 1.00
R4413:Exoc1 UTSW 5 76542019 intron probably benign
R4427:Exoc1 UTSW 5 76563263 missense probably benign 0.00
R4557:Exoc1 UTSW 5 76561443 missense probably damaging 1.00
R4627:Exoc1 UTSW 5 76542228 missense probably benign 0.26
R5138:Exoc1 UTSW 5 76568075 missense probably damaging 1.00
R5325:Exoc1 UTSW 5 76537702 missense probably benign
R5342:Exoc1 UTSW 5 76567014 missense probably damaging 1.00
R5736:Exoc1 UTSW 5 76537768 missense possibly damaging 0.90
R5891:Exoc1 UTSW 5 76542144 missense probably damaging 1.00
R6102:Exoc1 UTSW 5 76537779 missense probably damaging 1.00
R6447:Exoc1 UTSW 5 76543517 missense probably damaging 0.97
R6532:Exoc1 UTSW 5 76537837 missense probably damaging 0.99
R6694:Exoc1 UTSW 5 76549552 missense probably damaging 1.00
R6753:Exoc1 UTSW 5 76563339 missense probably damaging 1.00
R6885:Exoc1 UTSW 5 76559042 missense probably damaging 1.00
R7090:Exoc1 UTSW 5 76566953 missense unknown
R7299:Exoc1 UTSW 5 76542159 missense probably damaging 1.00
X0018:Exoc1 UTSW 5 76567035 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAACACAGCTTTCAAAGGTC -3'
(R):5'- GTGAAGCTGTTTCTCCAAATTCTGG -3'

Sequencing Primer
(F):5'- GGAACACAGCTTTCAAAGGTCTATTG -3'
(R):5'- GGATTCTGTCATTCCTCAAACAAC -3'
Posted On2015-10-08