Incidental Mutation 'R4677:Usp30'
ID349647
Institutional Source Beutler Lab
Gene Symbol Usp30
Ensembl Gene ENSMUSG00000029592
Gene Nameubiquitin specific peptidase 30
SynonymsD5Ertd483e, 6330590F17Rik
MMRRC Submission 042014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4677 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114065461-114124720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114119644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 288 (T288A)
Ref Sequence ENSEMBL: ENSMUSP00000031588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000200119]
Predicted Effect probably damaging
Transcript: ENSMUST00000031588
AA Change: T288A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592
AA Change: T288A

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053657
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112279
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197936
Predicted Effect possibly damaging
Transcript: ENSMUST00000200119
AA Change: T287A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592
AA Change: T287A

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] USP30, a member of the ubiquitin-specific protease family (see USP1, MIM 603478), is a novel mitochondrial deubiquitinating (DUB) enzyme (Nakamura and Hirose, 2008 [PubMed 18287522]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,404 C402S probably damaging Het
Adamts9 T C 6: 92,816,606 M1T probably null Het
Akap3 T C 6: 126,865,263 S282P probably damaging Het
Anxa10 A G 8: 62,063,020 I206T probably damaging Het
Apobec3 A G 15: 79,895,512 D52G probably damaging Het
Arl6 A T 16: 59,618,865 probably null Het
BC067074 A G 13: 113,379,486 T145A unknown Het
Calcoco1 T C 15: 102,717,894 E87G probably damaging Het
Ccdc88b C A 19: 6,848,268 A1206S probably damaging Het
Ccpg1 A G 9: 73,015,915 probably benign Het
Cdon A G 9: 35,478,605 N852D probably damaging Het
Cobl T A 11: 12,386,665 Q41L possibly damaging Het
Dcdc2b T C 4: 129,614,143 T39A probably damaging Het
Ddx55 A T 5: 124,567,934 D474V probably benign Het
Dnah17 A G 11: 118,119,814 L521P probably damaging Het
Exoc1 A G 5: 76,559,163 D497G probably null Het
Fam151a A G 4: 106,748,259 E606G possibly damaging Het
Fbxw11 T A 11: 32,742,535 L502* probably null Het
Fcrl1 A G 3: 87,390,256 S337G possibly damaging Het
G6pc C A 11: 101,376,613 F296L probably benign Het
Gm17472 C A 6: 42,980,875 T26N probably damaging Het
Gm9573 T A 17: 35,619,707 probably benign Het
Grin2b A G 6: 135,774,872 V564A probably benign Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hhip A G 8: 80,045,097 Y195H probably damaging Het
Igkc A T 6: 70,726,678 probably benign Het
Islr A T 9: 58,157,359 D288E probably damaging Het
Kdelr1 A G 7: 45,873,773 S36G probably benign Het
Lama5 G T 2: 180,179,366 H3134Q possibly damaging Het
Lor A G 3: 92,081,743 Y79H unknown Het
Lrp1b A G 2: 40,801,484 F3327S probably damaging Het
Lrrc41 C T 4: 116,095,135 H637Y probably benign Het
Map2k6 C T 11: 110,399,394 probably benign Het
Mcm3ap T G 10: 76,470,570 F172L probably damaging Het
Muc19 G A 15: 91,888,217 noncoding transcript Het
Muc6 T A 7: 141,639,790 probably benign Het
Nek1 A T 8: 61,028,806 I252L probably damaging Het
Nrg2 A T 18: 36,021,099 H588Q possibly damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Olfr1030 A G 2: 85,983,971 T44A possibly damaging Het
Olfr1046 A T 2: 86,217,688 S7R probably benign Het
Olfr340 A G 2: 36,453,050 N155S probably benign Het
Olfr64 T C 7: 103,893,408 E109G probably damaging Het
Pde3a A G 6: 141,466,139 N480D probably benign Het
Pde6c A G 19: 38,157,385 K374E probably damaging Het
Pdhx G A 2: 103,073,466 probably null Het
Pi4ka A G 16: 17,282,373 Y1888H probably damaging Het
Pnpla2 T A 7: 141,458,443 M203K probably damaging Het
Prrc2c C T 1: 162,705,179 probably benign Het
Ptcd3 G T 6: 71,893,514 H321N probably benign Het
Ptprt A G 2: 161,901,446 probably null Het
Ptx4 A G 17: 25,123,126 T192A probably benign Het
Qars A G 9: 108,509,690 probably benign Het
Ralgapa2 G A 2: 146,345,467 P1372S possibly damaging Het
Rps6ka4 G T 19: 6,839,486 T107K probably damaging Het
Rsf1 A G 7: 97,680,773 T1169A possibly damaging Het
Ryr2 C A 13: 11,706,667 W2626L probably damaging Het
Scn4a C T 11: 106,323,962 V1270I probably damaging Het
Serpinb9b T C 13: 33,039,823 S333P probably damaging Het
Sned1 A G 1: 93,296,297 probably benign Het
Sult1c2 C T 17: 53,830,109 V262M possibly damaging Het
Tll1 A T 8: 64,051,377 F662I probably benign Het
Tmem161a A T 8: 70,180,947 probably null Het
Top1mt A C 15: 75,664,058 V465G possibly damaging Het
Trcg1 A G 9: 57,245,861 K596E possibly damaging Het
Trim27 T A 13: 21,180,916 probably null Het
Trpm3 A G 19: 22,987,388 I1406V possibly damaging Het
Tssc4 T A 7: 143,070,509 S254T probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Usp48 C A 4: 137,616,381 R441S probably benign Het
Vmn1r29 T C 6: 58,307,300 S2P probably benign Het
Vmn2r65 T A 7: 84,963,874 I46L possibly damaging Het
Zeb1 A T 18: 5,766,775 I429F probably damaging Het
Zfp943 A G 17: 21,993,195 R421G probably benign Het
Other mutations in Usp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Usp30 APN 5 114121058 missense probably benign 0.00
IGL03384:Usp30 APN 5 114121574 missense probably damaging 1.00
R0095:Usp30 UTSW 5 114105840 missense probably damaging 1.00
R0972:Usp30 UTSW 5 114111864 splice site probably benign
R1184:Usp30 UTSW 5 114103827 critical splice donor site probably null
R1589:Usp30 UTSW 5 114112961 missense probably damaging 1.00
R1678:Usp30 UTSW 5 114121146 missense probably damaging 1.00
R2127:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2129:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2341:Usp30 UTSW 5 114111180 nonsense probably null
R5191:Usp30 UTSW 5 114065694 start gained probably benign
R5956:Usp30 UTSW 5 114119621 missense possibly damaging 0.89
R6730:Usp30 UTSW 5 114103709 missense probably damaging 1.00
R6947:Usp30 UTSW 5 114103760 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTACAAATGCAGGTCCCCTC -3'
(R):5'- ATACTTCACTCTGGAGTCTCATG -3'

Sequencing Primer
(F):5'- AATGCAGGTCCCCTCAGCTC -3'
(R):5'- CTCATGTATACAGCTTCTGGGGAC -3'
Posted On2015-10-08