Incidental Mutation 'R4677:Pi4ka'
ID349695
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 042014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4677 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17282373 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1888 (Y1888H)
Ref Sequence ENSEMBL: ENSMUSP00000156049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000164950] [ENSMUST00000232232] [ENSMUST00000232364]
Predicted Effect probably damaging
Transcript: ENSMUST00000036161
AA Change: Y1888H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: Y1888H

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148110
Predicted Effect probably damaging
Transcript: ENSMUST00000154364
AA Change: Y1888H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: Y1888H

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162522
Predicted Effect probably benign
Transcript: ENSMUST00000164950
SMART Domains Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
coiled coil region 5 112 N/A INTRINSIC
Pfam:TMEM191C 182 302 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232092
Predicted Effect probably benign
Transcript: ENSMUST00000232167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232220
Predicted Effect probably damaging
Transcript: ENSMUST00000232232
AA Change: Y1888H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232636
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,404 C402S probably damaging Het
Adamts9 T C 6: 92,816,606 M1T probably null Het
Akap3 T C 6: 126,865,263 S282P probably damaging Het
Anxa10 A G 8: 62,063,020 I206T probably damaging Het
Apobec3 A G 15: 79,895,512 D52G probably damaging Het
Arl6 A T 16: 59,618,865 probably null Het
BC067074 A G 13: 113,379,486 T145A unknown Het
Calcoco1 T C 15: 102,717,894 E87G probably damaging Het
Ccdc88b C A 19: 6,848,268 A1206S probably damaging Het
Ccpg1 A G 9: 73,015,915 probably benign Het
Cdon A G 9: 35,478,605 N852D probably damaging Het
Cobl T A 11: 12,386,665 Q41L possibly damaging Het
Dcdc2b T C 4: 129,614,143 T39A probably damaging Het
Ddx55 A T 5: 124,567,934 D474V probably benign Het
Dnah17 A G 11: 118,119,814 L521P probably damaging Het
Exoc1 A G 5: 76,559,163 D497G probably null Het
Fam151a A G 4: 106,748,259 E606G possibly damaging Het
Fbxw11 T A 11: 32,742,535 L502* probably null Het
Fcrl1 A G 3: 87,390,256 S337G possibly damaging Het
G6pc C A 11: 101,376,613 F296L probably benign Het
Gm17472 C A 6: 42,980,875 T26N probably damaging Het
Gm9573 T A 17: 35,619,707 probably benign Het
Grin2b A G 6: 135,774,872 V564A probably benign Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hhip A G 8: 80,045,097 Y195H probably damaging Het
Igkc A T 6: 70,726,678 probably benign Het
Islr A T 9: 58,157,359 D288E probably damaging Het
Kdelr1 A G 7: 45,873,773 S36G probably benign Het
Lama5 G T 2: 180,179,366 H3134Q possibly damaging Het
Lor A G 3: 92,081,743 Y79H unknown Het
Lrp1b A G 2: 40,801,484 F3327S probably damaging Het
Lrrc41 C T 4: 116,095,135 H637Y probably benign Het
Map2k6 C T 11: 110,399,394 probably benign Het
Mcm3ap T G 10: 76,470,570 F172L probably damaging Het
Muc19 G A 15: 91,888,217 noncoding transcript Het
Muc6 T A 7: 141,639,790 probably benign Het
Nek1 A T 8: 61,028,806 I252L probably damaging Het
Nrg2 A T 18: 36,021,099 H588Q possibly damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Olfr1030 A G 2: 85,983,971 T44A possibly damaging Het
Olfr1046 A T 2: 86,217,688 S7R probably benign Het
Olfr340 A G 2: 36,453,050 N155S probably benign Het
Olfr64 T C 7: 103,893,408 E109G probably damaging Het
Pde3a A G 6: 141,466,139 N480D probably benign Het
Pde6c A G 19: 38,157,385 K374E probably damaging Het
Pdhx G A 2: 103,073,466 probably null Het
Pnpla2 T A 7: 141,458,443 M203K probably damaging Het
Prrc2c C T 1: 162,705,179 probably benign Het
Ptcd3 G T 6: 71,893,514 H321N probably benign Het
Ptprt A G 2: 161,901,446 probably null Het
Ptx4 A G 17: 25,123,126 T192A probably benign Het
Qars A G 9: 108,509,690 probably benign Het
Ralgapa2 G A 2: 146,345,467 P1372S possibly damaging Het
Rps6ka4 G T 19: 6,839,486 T107K probably damaging Het
Rsf1 A G 7: 97,680,773 T1169A possibly damaging Het
Ryr2 C A 13: 11,706,667 W2626L probably damaging Het
Scn4a C T 11: 106,323,962 V1270I probably damaging Het
Serpinb9b T C 13: 33,039,823 S333P probably damaging Het
Sned1 A G 1: 93,296,297 probably benign Het
Sult1c2 C T 17: 53,830,109 V262M possibly damaging Het
Tll1 A T 8: 64,051,377 F662I probably benign Het
Tmem161a A T 8: 70,180,947 probably null Het
Top1mt A C 15: 75,664,058 V465G possibly damaging Het
Trcg1 A G 9: 57,245,861 K596E possibly damaging Het
Trim27 T A 13: 21,180,916 probably null Het
Trpm3 A G 19: 22,987,388 I1406V possibly damaging Het
Tssc4 T A 7: 143,070,509 S254T probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Usp30 A G 5: 114,119,644 T288A probably damaging Het
Usp48 C A 4: 137,616,381 R441S probably benign Het
Vmn1r29 T C 6: 58,307,300 S2P probably benign Het
Vmn2r65 T A 7: 84,963,874 I46L possibly damaging Het
Zeb1 A T 18: 5,766,775 I429F probably damaging Het
Zfp943 A G 17: 21,993,195 R421G probably benign Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATGGGCTGCCATTCTAGTTC -3'
(R):5'- TTCTCTCAGTGAAAGACAGAAGC -3'

Sequencing Primer
(F):5'- GCCAGCCACGTCTACAGTAGTG -3'
(R):5'- GAAGCCTAGAACCCCAGGG -3'
Posted On2015-10-08