Incidental Mutation 'R4678:Zeb2'
ID349722
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
MMRRC Submission 041931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4678 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44996341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 857 (D857E)
Ref Sequence ENSEMBL: ENSMUSP00000134747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844] [ENSMUST00000201804]
Predicted Effect probably benign
Transcript: ENSMUST00000028229
AA Change: D901E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: D901E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068415
AA Change: D857E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: D857E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076836
AA Change: D856E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: D856E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176438
AA Change: D857E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: D857E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177302
AA Change: D857E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: D857E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200844
AA Change: D833E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: D833E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201804
SMART Domains Protein: ENSMUSP00000144637
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
ZnF_C2H2 240 263 9.2e-6 SMART
ZnF_C2H2 270 292 4.2e-7 SMART
ZnF_C2H2 311 333 2e-6 SMART
ZnF_C2H2 339 359 8e-2 SMART
low complexity region 381 393 N/A INTRINSIC
ZnF_C2H2 610 630 2.4e-1 SMART
HOX 673 731 1.2e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T C 16: 89,063,985 probably benign Het
Abcc4 A G 14: 118,627,691 S308P probably damaging Het
Agr3 G T 12: 35,947,833 V115L probably damaging Het
Ahr A T 12: 35,507,464 I319N probably damaging Het
Alpk1 A T 3: 127,679,858 V832D probably damaging Het
Ano1 T C 7: 144,669,552 T78A probably benign Het
Apob G A 12: 7,995,585 G897D probably damaging Het
Arfgef1 A G 1: 10,142,666 F1677L probably benign Het
Arhgap40 G T 2: 158,532,306 G217W probably benign Het
Arhgef4 A G 1: 34,722,668 E335G unknown Het
Calcoco2 T C 11: 96,103,548 T60A probably damaging Het
Catsperg1 A T 7: 29,190,296 S741T probably benign Het
Ccdc181 T G 1: 164,278,277 I27S probably damaging Het
Ceacam9 A T 7: 16,725,409 Y211F probably damaging Het
Cep41 T C 6: 30,671,319 probably null Het
Cercam T A 2: 29,869,677 L45Q probably damaging Het
Cnnm2 G A 19: 46,763,246 V492M possibly damaging Het
Cntn3 A G 6: 102,204,020 V738A probably damaging Het
Coq8a T C 1: 180,170,081 E351G probably damaging Het
Cyp3a57 T C 5: 145,370,728 probably null Het
Dbn1 T C 13: 55,475,258 I471V probably benign Het
Ddx21 G T 10: 62,594,003 Q321K probably benign Het
Dhx8 T C 11: 101,739,808 V347A probably damaging Het
Dkc1 A G X: 75,100,992 I215V probably benign Homo
Dlg2 A G 7: 92,428,580 I685V possibly damaging Het
Dusp11 A C 6: 85,953,381 N140K probably damaging Het
Ece2 A G 16: 20,640,718 K454R probably damaging Het
Eno4 T A 19: 58,946,749 V131E probably damaging Het
Enpep A G 3: 129,303,713 probably null Het
Etv1 T C 12: 38,835,220 Y236H probably damaging Het
F2rl2 A G 13: 95,700,632 T62A probably benign Het
Fam196b T G 11: 34,403,227 L423R probably damaging Het
Fbxl21 T C 13: 56,537,049 V296A probably damaging Het
Fig4 T C 10: 41,272,998 I153V probably benign Het
Fis1 T A 5: 136,963,097 N41K possibly damaging Het
Fras1 T A 5: 96,700,568 M1814K probably benign Het
Frem2 T A 3: 53,544,371 I2266F probably benign Het
Gm10330 A T 12: 23,779,842 *113R probably null Het
Gm12185 T A 11: 48,915,540 I275F probably benign Het
Gsdme A T 6: 50,229,324 C180S possibly damaging Het
Herc1 A G 9: 66,416,269 E1355G probably benign Het
Hnrnpm A T 17: 33,650,211 I453N possibly damaging Het
Hspb9 T C 11: 100,714,070 L74P probably damaging Het
Ift46 C A 9: 44,783,963 Y85* probably null Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Isg20 C T 7: 78,914,328 probably benign Het
Itga11 T A 9: 62,735,357 N187K probably damaging Het
Klhl9 G A 4: 88,720,924 T360I probably damaging Het
Krt39 T A 11: 99,521,000 I87F probably benign Het
Krtap19-4 G A 16: 88,884,846 S74F unknown Het
Lgi1 G A 19: 38,301,289 V268I probably damaging Het
Lrrc46 G A 11: 97,034,893 P248S probably benign Het
Lrrn4 C T 2: 132,879,568 V110I probably benign Het
Mamstr C A 7: 45,644,692 probably benign Het
Micu3 T A 8: 40,380,677 F451I probably damaging Het
Mid1 C A X: 169,985,048 D130E possibly damaging Het
Mkks T C 2: 136,880,281 T319A probably benign Het
Mob3c A G 4: 115,833,771 probably null Het
Muc6 T C 7: 141,644,287 E1192G probably benign Het
Ndc80 A G 17: 71,520,758 probably null Het
Nfx1 A G 4: 41,012,070 K807E probably benign Het
Nrxn1 A T 17: 90,623,422 L181Q probably damaging Het
Nsun7 A G 5: 66,261,064 S46G probably benign Het
Nup98 A T 7: 102,184,831 L308H probably damaging Het
Olfr1079 T C 2: 86,538,733 M61V possibly damaging Het
Olfr1220 C A 2: 89,097,516 W137L probably benign Het
Olfr523 T C 7: 140,176,228 V36A probably benign Het
Olfr592 T C 7: 103,186,891 F97L probably damaging Het
Palb2 T C 7: 122,127,366 K427R probably damaging Het
Pcdha1 C A 18: 36,930,912 Q210K probably benign Het
Pcdhb2 T C 18: 37,296,207 L411P probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Plekhg4 T A 8: 105,380,371 Y899* probably null Het
Plxnb2 G T 15: 89,160,928 T1105K probably benign Het
Psmd2 T C 16: 20,659,969 V606A probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rassf8 A G 6: 145,815,082 K45E probably damaging Het
Rrn3 T A 16: 13,796,076 M284K probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Rtn2 C A 7: 19,293,895 N403K probably damaging Het
Rusc1 A G 3: 89,089,720 W462R probably damaging Het
Sdc3 T A 4: 130,818,596 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc12a2 T A 18: 57,905,960 C537* probably null Het
Slc4a2 G A 5: 24,434,240 probably null Het
Spsb4 T A 9: 96,995,691 D193V probably damaging Het
Strn A C 17: 78,677,351 F288V probably damaging Het
Stx18 G A 5: 38,136,368 probably benign Het
Tfcp2l1 T A 1: 118,668,648 M371K probably benign Het
Thnsl1 A G 2: 21,211,541 probably null Het
Tlr11 C T 14: 50,360,982 H142Y possibly damaging Het
Tor1aip2 T A 1: 156,065,034 I362K probably damaging Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Trpm8 T C 1: 88,337,129 V320A probably benign Het
Ubr3 A T 2: 69,935,919 H377L probably damaging Het
Usp8 A G 2: 126,725,429 R123G probably null Het
Vim T A 2: 13,574,964 L178Q probably damaging Het
Vmn1r231 A C 17: 20,890,227 V142G possibly damaging Het
Vmn1r83 A G 7: 12,321,770 M120T possibly damaging Het
Vwce G T 19: 10,664,648 V913F possibly damaging Het
Zbtb18 C A 1: 177,447,719 T215K probably benign Het
Zfp106 G A 2: 120,533,740 H729Y probably damaging Het
Zfp977 C A 7: 42,580,013 A363S probably benign Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1636:Zeb2 UTSW 2 45002611 missense probably damaging 1.00
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6402:Zeb2 UTSW 2 44996975 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6925:Zeb2 UTSW 2 44994529 missense probably damaging 1.00
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R6972:Zeb2 UTSW 2 44997318 missense probably damaging 1.00
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGCTCATCTGATCCAGTCCTG -3'
(R):5'- GTAGCTCGTACACTCCAAATAGC -3'

Sequencing Primer
(F):5'- CTGGGTATGGTCGTAGCCC -3'
(R):5'- CCAAATAGCTTCTCTTCCGAGG -3'
Posted On2015-10-08