Incidental Mutation 'R4678:Klhl9'
ID349741
Institutional Source Beutler Lab
Gene Symbol Klhl9
Ensembl Gene ENSMUSG00000070923
Gene Namekelch-like 9
SynonymsC530050O22Rik
MMRRC Submission 041931-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4678 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88718292-88722465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88720924 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 360 (T360I)
Ref Sequence ENSEMBL: ENSMUSP00000092602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]
Predicted Effect probably damaging
Transcript: ENSMUST00000094993
AA Change: T360I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923
AA Change: T360I

DomainStartEndE-ValueType
BTB 50 149 7.21e-22 SMART
BACK 154 255 3.93e-27 SMART
low complexity region 276 287 N/A INTRINSIC
Kelch 299 347 1.13e-2 SMART
Kelch 348 399 1.92e-5 SMART
Kelch 400 446 1.59e-11 SMART
Kelch 447 493 2.61e-7 SMART
Kelch 494 545 1.58e-6 SMART
Kelch 546 594 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181601
SMART Domains Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T C 16: 89,063,985 probably benign Het
Abcc4 A G 14: 118,627,691 S308P probably damaging Het
Agr3 G T 12: 35,947,833 V115L probably damaging Het
Ahr A T 12: 35,507,464 I319N probably damaging Het
Alpk1 A T 3: 127,679,858 V832D probably damaging Het
Ano1 T C 7: 144,669,552 T78A probably benign Het
Apob G A 12: 7,995,585 G897D probably damaging Het
Arfgef1 A G 1: 10,142,666 F1677L probably benign Het
Arhgap40 G T 2: 158,532,306 G217W probably benign Het
Arhgef4 A G 1: 34,722,668 E335G unknown Het
Calcoco2 T C 11: 96,103,548 T60A probably damaging Het
Catsperg1 A T 7: 29,190,296 S741T probably benign Het
Ccdc181 T G 1: 164,278,277 I27S probably damaging Het
Ceacam9 A T 7: 16,725,409 Y211F probably damaging Het
Cep41 T C 6: 30,671,319 probably null Het
Cercam T A 2: 29,869,677 L45Q probably damaging Het
Cnnm2 G A 19: 46,763,246 V492M possibly damaging Het
Cntn3 A G 6: 102,204,020 V738A probably damaging Het
Coq8a T C 1: 180,170,081 E351G probably damaging Het
Cyp3a57 T C 5: 145,370,728 probably null Het
Dbn1 T C 13: 55,475,258 I471V probably benign Het
Ddx21 G T 10: 62,594,003 Q321K probably benign Het
Dhx8 T C 11: 101,739,808 V347A probably damaging Het
Dkc1 A G X: 75,100,992 I215V probably benign Homo
Dlg2 A G 7: 92,428,580 I685V possibly damaging Het
Dusp11 A C 6: 85,953,381 N140K probably damaging Het
Ece2 A G 16: 20,640,718 K454R probably damaging Het
Eno4 T A 19: 58,946,749 V131E probably damaging Het
Enpep A G 3: 129,303,713 probably null Het
Etv1 T C 12: 38,835,220 Y236H probably damaging Het
F2rl2 A G 13: 95,700,632 T62A probably benign Het
Fam196b T G 11: 34,403,227 L423R probably damaging Het
Fbxl21 T C 13: 56,537,049 V296A probably damaging Het
Fig4 T C 10: 41,272,998 I153V probably benign Het
Fis1 T A 5: 136,963,097 N41K possibly damaging Het
Fras1 T A 5: 96,700,568 M1814K probably benign Het
Frem2 T A 3: 53,544,371 I2266F probably benign Het
Gm10330 A T 12: 23,779,842 *113R probably null Het
Gm12185 T A 11: 48,915,540 I275F probably benign Het
Gsdme A T 6: 50,229,324 C180S possibly damaging Het
Herc1 A G 9: 66,416,269 E1355G probably benign Het
Hnrnpm A T 17: 33,650,211 I453N possibly damaging Het
Hspb9 T C 11: 100,714,070 L74P probably damaging Het
Ift46 C A 9: 44,783,963 Y85* probably null Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Isg20 C T 7: 78,914,328 probably benign Het
Itga11 T A 9: 62,735,357 N187K probably damaging Het
Krt39 T A 11: 99,521,000 I87F probably benign Het
Krtap19-4 G A 16: 88,884,846 S74F unknown Het
Lgi1 G A 19: 38,301,289 V268I probably damaging Het
Lrrc46 G A 11: 97,034,893 P248S probably benign Het
Lrrn4 C T 2: 132,879,568 V110I probably benign Het
Mamstr C A 7: 45,644,692 probably benign Het
Micu3 T A 8: 40,380,677 F451I probably damaging Het
Mid1 C A X: 169,985,048 D130E possibly damaging Het
Mkks T C 2: 136,880,281 T319A probably benign Het
Mob3c A G 4: 115,833,771 probably null Het
Muc6 T C 7: 141,644,287 E1192G probably benign Het
Ndc80 A G 17: 71,520,758 probably null Het
Nfx1 A G 4: 41,012,070 K807E probably benign Het
Nrxn1 A T 17: 90,623,422 L181Q probably damaging Het
Nsun7 A G 5: 66,261,064 S46G probably benign Het
Nup98 A T 7: 102,184,831 L308H probably damaging Het
Olfr1079 T C 2: 86,538,733 M61V possibly damaging Het
Olfr1220 C A 2: 89,097,516 W137L probably benign Het
Olfr523 T C 7: 140,176,228 V36A probably benign Het
Olfr592 T C 7: 103,186,891 F97L probably damaging Het
Palb2 T C 7: 122,127,366 K427R probably damaging Het
Pcdha1 C A 18: 36,930,912 Q210K probably benign Het
Pcdhb2 T C 18: 37,296,207 L411P probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Plekhg4 T A 8: 105,380,371 Y899* probably null Het
Plxnb2 G T 15: 89,160,928 T1105K probably benign Het
Psmd2 T C 16: 20,659,969 V606A probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rassf8 A G 6: 145,815,082 K45E probably damaging Het
Rrn3 T A 16: 13,796,076 M284K probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Rtn2 C A 7: 19,293,895 N403K probably damaging Het
Rusc1 A G 3: 89,089,720 W462R probably damaging Het
Sdc3 T A 4: 130,818,596 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc12a2 T A 18: 57,905,960 C537* probably null Het
Slc4a2 G A 5: 24,434,240 probably null Het
Spsb4 T A 9: 96,995,691 D193V probably damaging Het
Strn A C 17: 78,677,351 F288V probably damaging Het
Stx18 G A 5: 38,136,368 probably benign Het
Tfcp2l1 T A 1: 118,668,648 M371K probably benign Het
Thnsl1 A G 2: 21,211,541 probably null Het
Tlr11 C T 14: 50,360,982 H142Y possibly damaging Het
Tor1aip2 T A 1: 156,065,034 I362K probably damaging Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Trpm8 T C 1: 88,337,129 V320A probably benign Het
Ubr3 A T 2: 69,935,919 H377L probably damaging Het
Usp8 A G 2: 126,725,429 R123G probably null Het
Vim T A 2: 13,574,964 L178Q probably damaging Het
Vmn1r231 A C 17: 20,890,227 V142G possibly damaging Het
Vmn1r83 A G 7: 12,321,770 M120T possibly damaging Het
Vwce G T 19: 10,664,648 V913F possibly damaging Het
Zbtb18 C A 1: 177,447,719 T215K probably benign Het
Zeb2 A T 2: 44,996,341 D857E probably damaging Het
Zfp106 G A 2: 120,533,740 H729Y probably damaging Het
Zfp977 C A 7: 42,580,013 A363S probably benign Het
Other mutations in Klhl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Klhl9 APN 4 88720819 missense probably damaging 1.00
IGL00592:Klhl9 APN 4 88721141 missense probably damaging 0.99
IGL01986:Klhl9 APN 4 88721779 missense probably damaging 0.99
IGL02364:Klhl9 APN 4 88721170 missense probably damaging 1.00
IGL02994:Klhl9 APN 4 88721197 nonsense probably null
minnow UTSW 4 88721606 nonsense probably null
R0319:Klhl9 UTSW 4 88720454 missense possibly damaging 0.91
R0360:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0364:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0693:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0961:Klhl9 UTSW 4 88721737 missense probably benign 0.16
R1521:Klhl9 UTSW 4 88721993 missense probably benign 0.03
R2891:Klhl9 UTSW 4 88720970 missense probably benign 0.02
R3762:Klhl9 UTSW 4 88721593 missense possibly damaging 0.93
R4584:Klhl9 UTSW 4 88721907 missense probably damaging 1.00
R4888:Klhl9 UTSW 4 88721945 missense probably benign 0.01
R5030:Klhl9 UTSW 4 88720534 missense possibly damaging 0.96
R5082:Klhl9 UTSW 4 88721385 missense probably damaging 0.97
R6466:Klhl9 UTSW 4 88721162 missense probably benign 0.00
R7032:Klhl9 UTSW 4 88721606 nonsense probably null
X0063:Klhl9 UTSW 4 88721951 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTGTAACATTCTACTGTGGCC -3'
(R):5'- GTCGGACAGAACTGCCATTC -3'

Sequencing Primer
(F):5'- CAGTTCACCAGCTGCACTG -3'
(R):5'- GGACAGAACTGCCATTCGATCTG -3'
Posted On2015-10-08