Incidental Mutation 'R0267:Dpyd'
ID34980
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
MMRRC Submission 038493-MU
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R0267 (G1)
Quality Score188
Status Not validated
Chromosome3
Chromosomal Location118562129-119432924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118917272 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 443 (E443G)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
Predicted Effect probably benign
Transcript: ENSMUST00000039177
AA Change: E443G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: E443G

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAGCAGATAATGCCTGAAACTCATC -3'
(R):5'- AGACCTTTTGAATCAAAATCGCTCGC -3'

Sequencing Primer
(F):5'- CCTGAAACTCATCTATGGTGGAAAAG -3'
(R):5'- TCGCTCGCAGTACATACAAG -3'
Posted On2013-05-09