Incidental Mutation 'R4678:Plxnb2'
ID349804
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission 041931-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R4678 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89160928 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1105 (T1105K)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably benign
Transcript: ENSMUST00000060808
AA Change: T1105K

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: T1105K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109331
AA Change: T1105K

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: T1105K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230393
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T C 16: 89,063,985 probably benign Het
Abcc4 A G 14: 118,627,691 S308P probably damaging Het
Agr3 G T 12: 35,947,833 V115L probably damaging Het
Ahr A T 12: 35,507,464 I319N probably damaging Het
Alpk1 A T 3: 127,679,858 V832D probably damaging Het
Ano1 T C 7: 144,669,552 T78A probably benign Het
Apob G A 12: 7,995,585 G897D probably damaging Het
Arfgef1 A G 1: 10,142,666 F1677L probably benign Het
Arhgap40 G T 2: 158,532,306 G217W probably benign Het
Arhgef4 A G 1: 34,722,668 E335G unknown Het
Calcoco2 T C 11: 96,103,548 T60A probably damaging Het
Catsperg1 A T 7: 29,190,296 S741T probably benign Het
Ccdc181 T G 1: 164,278,277 I27S probably damaging Het
Ceacam9 A T 7: 16,725,409 Y211F probably damaging Het
Cep41 T C 6: 30,671,319 probably null Het
Cercam T A 2: 29,869,677 L45Q probably damaging Het
Cnnm2 G A 19: 46,763,246 V492M possibly damaging Het
Cntn3 A G 6: 102,204,020 V738A probably damaging Het
Coq8a T C 1: 180,170,081 E351G probably damaging Het
Cyp3a57 T C 5: 145,370,728 probably null Het
Dbn1 T C 13: 55,475,258 I471V probably benign Het
Ddx21 G T 10: 62,594,003 Q321K probably benign Het
Dhx8 T C 11: 101,739,808 V347A probably damaging Het
Dkc1 A G X: 75,100,992 I215V probably benign Homo
Dlg2 A G 7: 92,428,580 I685V possibly damaging Het
Dusp11 A C 6: 85,953,381 N140K probably damaging Het
Ece2 A G 16: 20,640,718 K454R probably damaging Het
Eno4 T A 19: 58,946,749 V131E probably damaging Het
Enpep A G 3: 129,303,713 probably null Het
Etv1 T C 12: 38,835,220 Y236H probably damaging Het
F2rl2 A G 13: 95,700,632 T62A probably benign Het
Fam196b T G 11: 34,403,227 L423R probably damaging Het
Fbxl21 T C 13: 56,537,049 V296A probably damaging Het
Fig4 T C 10: 41,272,998 I153V probably benign Het
Fis1 T A 5: 136,963,097 N41K possibly damaging Het
Fras1 T A 5: 96,700,568 M1814K probably benign Het
Frem2 T A 3: 53,544,371 I2266F probably benign Het
Gm10330 A T 12: 23,779,842 *113R probably null Het
Gm12185 T A 11: 48,915,540 I275F probably benign Het
Gsdme A T 6: 50,229,324 C180S possibly damaging Het
Herc1 A G 9: 66,416,269 E1355G probably benign Het
Hnrnpm A T 17: 33,650,211 I453N possibly damaging Het
Hspb9 T C 11: 100,714,070 L74P probably damaging Het
Ift46 C A 9: 44,783,963 Y85* probably null Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Isg20 C T 7: 78,914,328 probably benign Het
Itga11 T A 9: 62,735,357 N187K probably damaging Het
Klhl9 G A 4: 88,720,924 T360I probably damaging Het
Krt39 T A 11: 99,521,000 I87F probably benign Het
Krtap19-4 G A 16: 88,884,846 S74F unknown Het
Lgi1 G A 19: 38,301,289 V268I probably damaging Het
Lrrc46 G A 11: 97,034,893 P248S probably benign Het
Lrrn4 C T 2: 132,879,568 V110I probably benign Het
Mamstr C A 7: 45,644,692 probably benign Het
Micu3 T A 8: 40,380,677 F451I probably damaging Het
Mid1 C A X: 169,985,048 D130E possibly damaging Het
Mkks T C 2: 136,880,281 T319A probably benign Het
Mob3c A G 4: 115,833,771 probably null Het
Muc6 T C 7: 141,644,287 E1192G probably benign Het
Ndc80 A G 17: 71,520,758 probably null Het
Nfx1 A G 4: 41,012,070 K807E probably benign Het
Nrxn1 A T 17: 90,623,422 L181Q probably damaging Het
Nsun7 A G 5: 66,261,064 S46G probably benign Het
Nup98 A T 7: 102,184,831 L308H probably damaging Het
Olfr1079 T C 2: 86,538,733 M61V possibly damaging Het
Olfr1220 C A 2: 89,097,516 W137L probably benign Het
Olfr523 T C 7: 140,176,228 V36A probably benign Het
Olfr592 T C 7: 103,186,891 F97L probably damaging Het
Palb2 T C 7: 122,127,366 K427R probably damaging Het
Pcdha1 C A 18: 36,930,912 Q210K probably benign Het
Pcdhb2 T C 18: 37,296,207 L411P probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Plekhg4 T A 8: 105,380,371 Y899* probably null Het
Psmd2 T C 16: 20,659,969 V606A probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rassf8 A G 6: 145,815,082 K45E probably damaging Het
Rrn3 T A 16: 13,796,076 M284K probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Rtn2 C A 7: 19,293,895 N403K probably damaging Het
Rusc1 A G 3: 89,089,720 W462R probably damaging Het
Sdc3 T A 4: 130,818,596 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc12a2 T A 18: 57,905,960 C537* probably null Het
Slc4a2 G A 5: 24,434,240 probably null Het
Spsb4 T A 9: 96,995,691 D193V probably damaging Het
Strn A C 17: 78,677,351 F288V probably damaging Het
Stx18 G A 5: 38,136,368 probably benign Het
Tfcp2l1 T A 1: 118,668,648 M371K probably benign Het
Thnsl1 A G 2: 21,211,541 probably null Het
Tlr11 C T 14: 50,360,982 H142Y possibly damaging Het
Tor1aip2 T A 1: 156,065,034 I362K probably damaging Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Trpm8 T C 1: 88,337,129 V320A probably benign Het
Ubr3 A T 2: 69,935,919 H377L probably damaging Het
Usp8 A G 2: 126,725,429 R123G probably null Het
Vim T A 2: 13,574,964 L178Q probably damaging Het
Vmn1r231 A C 17: 20,890,227 V142G possibly damaging Het
Vmn1r83 A G 7: 12,321,770 M120T possibly damaging Het
Vwce G T 19: 10,664,648 V913F possibly damaging Het
Zbtb18 C A 1: 177,447,719 T215K probably benign Het
Zeb2 A T 2: 44,996,341 D857E probably damaging Het
Zfp106 G A 2: 120,533,740 H729Y probably damaging Het
Zfp977 C A 7: 42,580,013 A363S probably benign Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTCAGCGTCTTCATAATGCAAC -3'
(R):5'- AGTACGTGTTCTACAACGACACC -3'

Sequencing Primer
(F):5'- GTCTTCATAATGCAACGCTCAG -3'
(R):5'- ACGACACCAAGGTCGTCTTCTTG -3'
Posted On2015-10-08