Incidental Mutation 'R3162:Disp1'
ID 349824
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Name dispatched RND transporter family member 1
Synonyms DispA, 1190008H24Rik
MMRRC Submission 040613-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R3162 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 182867830-183003086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 182868806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1205 (K1205E)
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
AlphaFold Q3TDN0
Predicted Effect probably benign
Transcript: ENSMUST00000003035
AA Change: K1205E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: K1205E

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171366
AA Change: K1205E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: K1205E

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195372
AA Change: K1205E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: K1205E

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 59,888,134 (GRCm39) E102V probably damaging Het
9930014A18Rik A T 15: 60,695,296 (GRCm39) V150E probably damaging Het
Adcy9 A G 16: 4,129,452 (GRCm39) L715P probably damaging Het
Atad2b C A 12: 4,989,689 (GRCm39) N133K possibly damaging Het
AW551984 C A 9: 39,504,325 (GRCm39) R547L probably damaging Het
B3galt6 A G 4: 156,076,464 (GRCm39) Y204H probably benign Het
Camk1g T C 1: 193,042,115 (GRCm39) T45A possibly damaging Het
Caps2 C A 10: 112,018,391 (GRCm39) Y180* probably null Het
Cfap54 T A 10: 92,881,140 (GRCm39) K349N probably damaging Het
Copa T A 1: 171,918,800 (GRCm39) C127S probably damaging Het
Dapk2 T G 9: 66,161,893 (GRCm39) V267G probably damaging Het
Ddb1 T C 19: 10,603,335 (GRCm39) L881P probably damaging Het
Decr1 T A 4: 15,930,972 (GRCm39) D120V probably damaging Het
Dennd1c C T 17: 57,373,562 (GRCm39) G637D possibly damaging Het
Dhrs3 A G 4: 144,646,016 (GRCm39) D108G possibly damaging Het
Dusp6 T C 10: 99,099,944 (GRCm39) Y131H probably damaging Het
Eif2b2 A T 12: 85,266,435 (GRCm39) M34L probably benign Het
Errfi1 G A 4: 150,951,816 (GRCm39) E415K probably damaging Het
Ext1 T C 15: 53,208,000 (GRCm39) N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,612,561 (GRCm39) noncoding transcript Het
Hnrnpu T C 1: 178,158,690 (GRCm39) probably benign Het
Hpx C T 7: 105,248,847 (GRCm39) probably benign Het
Hyal3 T A 9: 107,464,005 (GRCm39) C407S probably damaging Het
Insr T G 8: 3,211,416 (GRCm39) N1141T possibly damaging Het
Ipo9 T C 1: 135,337,214 (GRCm39) T174A probably benign Het
Ivd T C 2: 118,692,650 (GRCm39) probably null Het
Leprot C T 4: 101,515,090 (GRCm39) T89I probably damaging Het
Msh6 T C 17: 88,292,909 (GRCm39) Y555H probably damaging Het
Nup155 G T 15: 8,177,867 (GRCm39) R1083S possibly damaging Het
Nusap1 A T 2: 119,460,885 (GRCm39) Q126L possibly damaging Het
Or13c7b T A 4: 43,820,544 (GRCm39) K272N probably benign Het
Or5al1 T C 2: 85,990,439 (GRCm39) I92V probably benign Het
Or6x1 G T 9: 40,098,901 (GRCm39) Q163H probably benign Het
Or7a35 C A 10: 78,853,438 (GRCm39) T94N probably benign Het
Pdik1l A G 4: 134,011,561 (GRCm39) L94S probably damaging Het
Pkdrej T A 15: 85,700,818 (GRCm39) D1706V probably damaging Het
Pkhd1l1 A G 15: 44,368,924 (GRCm39) I856M probably damaging Het
Prkcz A T 4: 155,374,981 (GRCm39) D114E probably benign Het
Psap T C 10: 60,113,575 (GRCm39) L4P possibly damaging Het
Ptprk T C 10: 28,468,822 (GRCm39) V1402A probably benign Het
Rai14 T C 15: 10,633,250 (GRCm39) T47A possibly damaging Het
Rlf A G 4: 121,006,044 (GRCm39) S979P probably damaging Het
Skic2 C T 17: 35,066,789 (GRCm39) W88* probably null Het
Skic8 T A 9: 54,631,473 (GRCm39) probably benign Het
Srbd1 A T 17: 86,437,643 (GRCm39) D233E probably benign Het
Tacr2 A G 10: 62,101,024 (GRCm39) D378G probably benign Het
Taok2 A G 7: 126,474,347 (GRCm39) I294T possibly damaging Het
Tert A G 13: 73,775,528 (GRCm39) E93G possibly damaging Het
Tns2 A G 15: 102,021,771 (GRCm39) E1118G possibly damaging Het
Ttc22 A T 4: 106,480,276 (GRCm39) I177F probably damaging Het
Vmn2r86 T C 10: 130,291,673 (GRCm39) R31G probably damaging Het
Wnt5a T C 14: 28,244,445 (GRCm39) Y231H probably benign Het
Zw10 T C 9: 48,988,860 (GRCm39) Y709H probably damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB006:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
BB016:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R1120:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably benign 0.24
R1482:Disp1 UTSW 1 182,868,038 (GRCm39) missense possibly damaging 0.61
R1655:Disp1 UTSW 1 182,868,568 (GRCm39) missense probably benign 0.01
R1660:Disp1 UTSW 1 182,869,306 (GRCm39) missense probably damaging 1.00
R1816:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably damaging 0.99
R1835:Disp1 UTSW 1 182,870,564 (GRCm39) missense probably damaging 1.00
R1954:Disp1 UTSW 1 182,870,107 (GRCm39) missense probably damaging 0.99
R2025:Disp1 UTSW 1 182,869,767 (GRCm39) missense probably damaging 1.00
R2136:Disp1 UTSW 1 182,869,942 (GRCm39) missense probably damaging 1.00
R2150:Disp1 UTSW 1 182,869,936 (GRCm39) missense probably damaging 1.00
R2207:Disp1 UTSW 1 182,869,906 (GRCm39) missense possibly damaging 0.94
R2392:Disp1 UTSW 1 182,868,731 (GRCm39) missense probably benign
R2831:Disp1 UTSW 1 182,870,883 (GRCm39) small deletion probably benign
R3111:Disp1 UTSW 1 182,869,087 (GRCm39) missense probably damaging 1.00
R3116:Disp1 UTSW 1 182,870,486 (GRCm39) missense probably benign 0.01
R3160:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3161:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3716:Disp1 UTSW 1 182,869,315 (GRCm39) missense probably damaging 1.00
R3914:Disp1 UTSW 1 182,870,666 (GRCm39) missense probably benign 0.05
R4061:Disp1 UTSW 1 182,869,264 (GRCm39) missense probably damaging 0.96
R4191:Disp1 UTSW 1 182,870,737 (GRCm39) missense probably damaging 1.00
R4261:Disp1 UTSW 1 182,870,950 (GRCm39) missense probably damaging 1.00
R4272:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4273:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4351:Disp1 UTSW 1 182,881,542 (GRCm39) missense probably benign 0.01
R4672:Disp1 UTSW 1 182,880,215 (GRCm39) critical splice acceptor site probably null
R4764:Disp1 UTSW 1 182,869,660 (GRCm39) missense probably damaging 1.00
R4910:Disp1 UTSW 1 182,917,027 (GRCm39) missense probably damaging 1.00
R5150:Disp1 UTSW 1 182,871,063 (GRCm39) missense probably damaging 0.98
R5502:Disp1 UTSW 1 182,869,450 (GRCm39) missense probably damaging 1.00
R5616:Disp1 UTSW 1 182,869,913 (GRCm39) missense probably benign 0.30
R5699:Disp1 UTSW 1 182,870,119 (GRCm39) nonsense probably null
R5813:Disp1 UTSW 1 182,869,974 (GRCm39) missense probably damaging 1.00
R5820:Disp1 UTSW 1 182,917,151 (GRCm39) missense probably benign 0.00
R6184:Disp1 UTSW 1 182,867,896 (GRCm39) missense probably benign 0.00
R6228:Disp1 UTSW 1 182,880,589 (GRCm39) missense possibly damaging 0.59
R6306:Disp1 UTSW 1 182,868,712 (GRCm39) missense possibly damaging 0.93
R6505:Disp1 UTSW 1 182,868,076 (GRCm39) missense probably benign 0.02
R6925:Disp1 UTSW 1 182,868,042 (GRCm39) missense probably benign
R7016:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7045:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7046:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7047:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7114:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7123:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7124:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7125:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7161:Disp1 UTSW 1 182,869,189 (GRCm39) missense possibly damaging 0.84
R7510:Disp1 UTSW 1 182,869,975 (GRCm39) missense probably damaging 1.00
R7756:Disp1 UTSW 1 182,871,298 (GRCm39) missense probably damaging 1.00
R7800:Disp1 UTSW 1 182,880,550 (GRCm39) missense probably benign 0.00
R7929:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R8029:Disp1 UTSW 1 182,870,852 (GRCm39) missense probably damaging 1.00
R8036:Disp1 UTSW 1 182,870,803 (GRCm39) missense probably damaging 1.00
R8045:Disp1 UTSW 1 182,870,794 (GRCm39) missense probably damaging 1.00
R8054:Disp1 UTSW 1 182,869,812 (GRCm39) nonsense probably null
R8061:Disp1 UTSW 1 182,869,151 (GRCm39) missense probably damaging 1.00
R8094:Disp1 UTSW 1 182,869,192 (GRCm39) missense probably damaging 1.00
R8130:Disp1 UTSW 1 182,917,199 (GRCm39) missense probably benign 0.13
R8731:Disp1 UTSW 1 182,869,072 (GRCm39) missense possibly damaging 0.65
R9076:Disp1 UTSW 1 182,868,799 (GRCm39) missense possibly damaging 0.59
R9490:Disp1 UTSW 1 182,871,092 (GRCm39) missense probably benign 0.03
R9712:Disp1 UTSW 1 182,917,379 (GRCm39) missense probably damaging 0.99
R9745:Disp1 UTSW 1 182,869,310 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCGGCAGTTACATCTCGG -3'
(R):5'- CATGATGCTCGTCATGTGCG -3'

Sequencing Primer
(F):5'- CGGCAGTTACATCTCGGATTGAG -3'
(R):5'- TTTCCCTACAAAACTCCAGTGCAG -3'
Posted On 2015-10-08