Incidental Mutation 'R3162:Olfr986'
ID349845
Institutional Source Beutler Lab
Gene Symbol Olfr986
Ensembl Gene ENSMUSG00000051095
Gene Nameolfactory receptor 986
SynonymsMOR104-3, GA_x6K02T2PVTD-33886895-33887833
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40180920-40190134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40187605 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 163 (Q163H)
Ref Sequence ENSEMBL: ENSMUSP00000152019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026693] [ENSMUST00000062229] [ENSMUST00000168691] [ENSMUST00000168832] [ENSMUST00000214763] [ENSMUST00000216720] [ENSMUST00000218134]
Predicted Effect probably benign
Transcript: ENSMUST00000026693
SMART Domains Protein: ENSMUSP00000026693
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 297 1.7e-17 SMART
ZnF_C2H2 391 413 9.44e-2 SMART
ZnF_C2H2 419 441 6.42e-4 SMART
ZnF_C2H2 473 495 3.44e-4 SMART
ZnF_C2H2 501 523 1.47e-3 SMART
ZnF_C2H2 529 551 1.64e-1 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 8.47e-4 SMART
ZnF_C2H2 613 635 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062229
AA Change: Q163H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000056713
Gene: ENSMUSG00000051095
AA Change: Q163H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.1e-54 PFAM
Pfam:7tm_1 39 288 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168691
SMART Domains Protein: ENSMUSP00000130163
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 132 1.03e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168832
SMART Domains Protein: ENSMUSP00000132131
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 277 5.32e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214763
AA Change: Q163H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216720
AA Change: Q163H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000218134
AA Change: Q163H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Olfr986
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr986 APN 9 40187756 missense probably benign 0.01
IGL02342:Olfr986 APN 9 40187527 missense probably benign
IGL02961:Olfr986 APN 9 40187601 missense probably benign 0.00
R0379:Olfr986 UTSW 9 40187433 missense probably damaging 1.00
R1411:Olfr986 UTSW 9 40187139 missense possibly damaging 0.93
R1712:Olfr986 UTSW 9 40187865 missense probably damaging 1.00
R1818:Olfr986 UTSW 9 40187262 missense probably benign
R2249:Olfr986 UTSW 9 40187684 missense possibly damaging 0.59
R3162:Olfr986 UTSW 9 40187605 missense probably benign 0.02
R5071:Olfr986 UTSW 9 40187664 missense probably damaging 1.00
R5464:Olfr986 UTSW 9 40187784 missense probably damaging 1.00
R5475:Olfr986 UTSW 9 40187709 missense possibly damaging 0.84
R5695:Olfr986 UTSW 9 40187601 missense probably benign 0.00
R5878:Olfr986 UTSW 9 40187571 missense probably benign 0.02
R6978:Olfr986 UTSW 9 40187789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGAGTTCTTGATTCTGGGC -3'
(R):5'- ACTACTGTCAGGTGAGAGGC -3'

Sequencing Primer
(F):5'- CTTGATTCTGGGCAGCATGTC -3'
(R):5'- GCACAAGTAGAAAAAGCCTTTTG -3'
Posted On2015-10-08