Incidental Mutation 'R4681:Cox10'
ID 350039
Institutional Source Beutler Lab
Gene Symbol Cox10
Ensembl Gene ENSMUSG00000042148
Gene Name heme A:farnesyltransferase cytochrome c oxidase assembly factor 10
Synonyms 2410004F01Rik
MMRRC Submission 042015-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R4681 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 63853453-63970294 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63867277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 240 (T240P)
Ref Sequence ENSEMBL: ENSMUSP00000040138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049091]
AlphaFold Q8CFY5
Predicted Effect possibly damaging
Transcript: ENSMUST00000049091
AA Change: T240P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040138
Gene: ENSMUSG00000042148
AA Change: T240P

DomainStartEndE-ValueType
Pfam:UbiA 168 418 5e-58 PFAM
Meta Mutation Damage Score 0.3410 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes heme A:farnesyltransferase, which is not a structural subunit but required for the expression of functional COX and functions in the maturation of the heme A prosthetic group of COX. This protein is predicted to contain 7-9 transmembrane domains localized in the mitochondrial inner membrane. A gene mutation, which results in the substitution of a lysine for an asparagine (N204K), is identified to be responsible for cytochrome c oxidase deficiency. In addition, this gene is disrupted in patients with CMT1A (Charcot-Marie-Tooth type 1A) duplication and with HNPP (hereditary neuropathy with liability to pressure palsies) deletion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,580,361 (GRCm39) T1947K probably benign Het
Ak9 A C 10: 41,303,234 (GRCm39) K1669T unknown Het
Atp4b T C 8: 13,439,700 (GRCm39) E174G probably benign Het
Bcl6 A G 16: 23,787,203 (GRCm39) probably benign Het
Brca2 C G 5: 150,475,863 (GRCm39) probably null Het
Btnl4 A T 17: 34,689,075 (GRCm39) probably null Het
C4a G T 17: 35,036,075 (GRCm39) noncoding transcript Het
Cab39l A G 14: 59,737,054 (GRCm39) D58G probably benign Het
Cacna2d3 A T 14: 29,015,092 (GRCm39) M100K probably damaging Het
Car2 T A 3: 14,960,624 (GRCm39) Y127* probably null Het
Cdhr1 T C 14: 36,818,194 (GRCm39) N86S probably benign Het
Celsr3 A G 9: 108,704,953 (GRCm39) I479V possibly damaging Het
Cfhr1 A T 1: 139,478,667 (GRCm39) Y53* probably null Het
Cgrrf1 A G 14: 47,091,283 (GRCm39) E269G probably benign Het
Cimap3 C A 3: 105,905,701 (GRCm39) G148C probably damaging Het
Clcn7 A T 17: 25,376,935 (GRCm39) H636L probably damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 133,800,029 (GRCm39) probably null Het
Dbt A G 3: 116,326,963 (GRCm39) D104G probably damaging Het
F730035P03Rik T C 7: 99,429,425 (GRCm39) noncoding transcript Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam186b T C 15: 99,178,771 (GRCm39) K185R probably benign Het
Fat4 T C 3: 38,941,491 (GRCm39) L128P probably damaging Het
Gbf1 A T 19: 46,268,989 (GRCm39) Q1381L probably benign Het
Glp2r C T 11: 67,621,453 (GRCm39) probably null Het
Gm18025 A G 12: 34,340,884 (GRCm39) S70P probably benign Het
Gpr45 A G 1: 43,072,068 (GRCm39) D237G probably benign Het
Hectd4 A T 5: 121,441,678 (GRCm39) L1213F possibly damaging Het
Hydin T C 8: 111,233,103 (GRCm39) V1734A possibly damaging Het
Kcnh5 A T 12: 75,054,397 (GRCm39) S516T probably benign Het
Liph A C 16: 21,802,777 (GRCm39) S97R probably benign Het
Mtcl1 T C 17: 66,756,139 (GRCm39) T68A unknown Het
Nsun7 T A 5: 66,418,542 (GRCm39) S91T probably benign Het
Or5an10 T C 19: 12,276,413 (GRCm39) T28A probably benign Het
Or6c75 A G 10: 129,337,433 (GRCm39) I227V probably damaging Het
Pcdh20 A T 14: 88,705,052 (GRCm39) N749K probably damaging Het
Pot1b A T 17: 55,961,831 (GRCm39) D582E probably benign Het
Pxdn T C 12: 30,062,325 (GRCm39) I1212T probably benign Het
Ramp1 T C 1: 91,124,511 (GRCm39) V24A probably benign Het
S100a8 T A 3: 90,576,890 (GRCm39) D14E probably benign Het
Stk31 A G 6: 49,414,369 (GRCm39) D501G probably benign Het
Tbc1d19 G A 5: 54,029,595 (GRCm39) V319M probably damaging Het
Tbcel G T 9: 42,361,268 (GRCm39) H93Q probably damaging Het
Traf3ip2 C T 10: 39,515,256 (GRCm39) P345S possibly damaging Het
Trpm8 A T 1: 88,312,427 (GRCm39) I1103F possibly damaging Het
Ttc19 T A 11: 62,199,917 (GRCm39) C112* probably null Het
Unc5c T G 3: 141,474,374 (GRCm39) probably null Het
Urb1 A T 16: 90,601,425 (GRCm39) H115Q probably damaging Het
Vmn2r15 T A 5: 109,434,488 (GRCm39) I739F probably damaging Het
Zcchc14 G T 8: 122,335,339 (GRCm39) probably benign Het
Zfp408 G A 2: 91,476,131 (GRCm39) P341L probably damaging Het
Zfp638 G A 6: 83,958,719 (GRCm39) V1166M possibly damaging Het
Other mutations in Cox10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02746:Cox10 APN 11 63,855,357 (GRCm39) splice site probably benign
PIT4504001:Cox10 UTSW 11 63,855,042 (GRCm39) missense possibly damaging 0.66
R0548:Cox10 UTSW 11 63,867,178 (GRCm39) missense probably damaging 1.00
R0811:Cox10 UTSW 11 63,962,539 (GRCm39) missense probably benign
R0812:Cox10 UTSW 11 63,962,539 (GRCm39) missense probably benign
R2175:Cox10 UTSW 11 63,962,475 (GRCm39) missense probably benign 0.01
R4290:Cox10 UTSW 11 63,855,081 (GRCm39) missense probably benign 0.00
R4770:Cox10 UTSW 11 63,854,989 (GRCm39) missense probably benign 0.00
R5873:Cox10 UTSW 11 63,962,512 (GRCm39) missense probably benign 0.00
R6457:Cox10 UTSW 11 63,855,198 (GRCm39) missense probably damaging 0.99
R7955:Cox10 UTSW 11 63,884,750 (GRCm39) missense probably benign 0.25
R8731:Cox10 UTSW 11 63,855,045 (GRCm39) missense probably damaging 1.00
R8821:Cox10 UTSW 11 63,855,306 (GRCm39) missense probably damaging 1.00
R8831:Cox10 UTSW 11 63,855,306 (GRCm39) missense probably damaging 1.00
R8883:Cox10 UTSW 11 63,884,775 (GRCm39) missense probably damaging 1.00
R9684:Cox10 UTSW 11 63,855,207 (GRCm39) missense probably damaging 1.00
X0064:Cox10 UTSW 11 63,884,783 (GRCm39) critical splice acceptor site probably null
Z1177:Cox10 UTSW 11 63,867,296 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGCACCAGGAGACACTTACC -3'
(R):5'- AGCTTCTTTACAGTCTCAGGAAG -3'

Sequencing Primer
(F):5'- AGCATCAAGGCTTCCAGTG -3'
(R):5'- TCTCAGGAAGACTCCCCATGG -3'
Posted On 2015-10-08