Incidental Mutation 'R4681:Bcl6'
ID 350051
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene Name B cell leukemia/lymphoma 6
Synonyms Bcl5
MMRRC Submission 042015-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R4681 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 23783802-23807602 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 23787203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
AlphaFold P41183
Predicted Effect probably benign
Transcript: ENSMUST00000023151
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508

DomainStartEndE-ValueType
BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135352
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,580,361 (GRCm39) T1947K probably benign Het
Ak9 A C 10: 41,303,234 (GRCm39) K1669T unknown Het
Atp4b T C 8: 13,439,700 (GRCm39) E174G probably benign Het
Brca2 C G 5: 150,475,863 (GRCm39) probably null Het
Btnl4 A T 17: 34,689,075 (GRCm39) probably null Het
C4a G T 17: 35,036,075 (GRCm39) noncoding transcript Het
Cab39l A G 14: 59,737,054 (GRCm39) D58G probably benign Het
Cacna2d3 A T 14: 29,015,092 (GRCm39) M100K probably damaging Het
Car2 T A 3: 14,960,624 (GRCm39) Y127* probably null Het
Cdhr1 T C 14: 36,818,194 (GRCm39) N86S probably benign Het
Celsr3 A G 9: 108,704,953 (GRCm39) I479V possibly damaging Het
Cfhr1 A T 1: 139,478,667 (GRCm39) Y53* probably null Het
Cgrrf1 A G 14: 47,091,283 (GRCm39) E269G probably benign Het
Cimap3 C A 3: 105,905,701 (GRCm39) G148C probably damaging Het
Clcn7 A T 17: 25,376,935 (GRCm39) H636L probably damaging Het
Cox10 T G 11: 63,867,277 (GRCm39) T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 133,800,029 (GRCm39) probably null Het
Dbt A G 3: 116,326,963 (GRCm39) D104G probably damaging Het
F730035P03Rik T C 7: 99,429,425 (GRCm39) noncoding transcript Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam186b T C 15: 99,178,771 (GRCm39) K185R probably benign Het
Fat4 T C 3: 38,941,491 (GRCm39) L128P probably damaging Het
Gbf1 A T 19: 46,268,989 (GRCm39) Q1381L probably benign Het
Glp2r C T 11: 67,621,453 (GRCm39) probably null Het
Gm18025 A G 12: 34,340,884 (GRCm39) S70P probably benign Het
Gpr45 A G 1: 43,072,068 (GRCm39) D237G probably benign Het
Hectd4 A T 5: 121,441,678 (GRCm39) L1213F possibly damaging Het
Hydin T C 8: 111,233,103 (GRCm39) V1734A possibly damaging Het
Kcnh5 A T 12: 75,054,397 (GRCm39) S516T probably benign Het
Liph A C 16: 21,802,777 (GRCm39) S97R probably benign Het
Mtcl1 T C 17: 66,756,139 (GRCm39) T68A unknown Het
Nsun7 T A 5: 66,418,542 (GRCm39) S91T probably benign Het
Or5an10 T C 19: 12,276,413 (GRCm39) T28A probably benign Het
Or6c75 A G 10: 129,337,433 (GRCm39) I227V probably damaging Het
Pcdh20 A T 14: 88,705,052 (GRCm39) N749K probably damaging Het
Pot1b A T 17: 55,961,831 (GRCm39) D582E probably benign Het
Pxdn T C 12: 30,062,325 (GRCm39) I1212T probably benign Het
Ramp1 T C 1: 91,124,511 (GRCm39) V24A probably benign Het
S100a8 T A 3: 90,576,890 (GRCm39) D14E probably benign Het
Stk31 A G 6: 49,414,369 (GRCm39) D501G probably benign Het
Tbc1d19 G A 5: 54,029,595 (GRCm39) V319M probably damaging Het
Tbcel G T 9: 42,361,268 (GRCm39) H93Q probably damaging Het
Traf3ip2 C T 10: 39,515,256 (GRCm39) P345S possibly damaging Het
Trpm8 A T 1: 88,312,427 (GRCm39) I1103F possibly damaging Het
Ttc19 T A 11: 62,199,917 (GRCm39) C112* probably null Het
Unc5c T G 3: 141,474,374 (GRCm39) probably null Het
Urb1 A T 16: 90,601,425 (GRCm39) H115Q probably damaging Het
Vmn2r15 T A 5: 109,434,488 (GRCm39) I739F probably damaging Het
Zcchc14 G T 8: 122,335,339 (GRCm39) probably benign Het
Zfp408 G A 2: 91,476,131 (GRCm39) P341L probably damaging Het
Zfp638 G A 6: 83,958,719 (GRCm39) V1166M possibly damaging Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23,793,641 (GRCm39) missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23,796,319 (GRCm39) missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23,793,788 (GRCm39) splice site probably benign
IGL03271:Bcl6 APN 16 23,788,756 (GRCm39) missense probably benign 0.00
Adriatic UTSW 16 23,786,883 (GRCm39) missense probably damaging 0.99
Catanzaro UTSW 16 23,784,976 (GRCm39) nonsense probably null
Density UTSW 16 23,788,798 (GRCm39) missense possibly damaging 0.91
nouvelle UTSW 16 23,788,736 (GRCm39) missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23,784,969 (GRCm39) missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23,791,344 (GRCm39) missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23,786,889 (GRCm39) missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23,784,905 (GRCm39) missense probably benign
R1134:Bcl6 UTSW 16 23,787,115 (GRCm39) missense probably benign
R1317:Bcl6 UTSW 16 23,796,292 (GRCm39) missense probably damaging 1.00
R1325:Bcl6 UTSW 16 23,791,097 (GRCm39) missense probably benign 0.02
R1393:Bcl6 UTSW 16 23,796,316 (GRCm39) missense probably damaging 0.99
R1761:Bcl6 UTSW 16 23,796,292 (GRCm39) missense probably damaging 1.00
R2170:Bcl6 UTSW 16 23,793,680 (GRCm39) missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23,791,382 (GRCm39) nonsense probably null
R2293:Bcl6 UTSW 16 23,796,359 (GRCm39) missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23,786,869 (GRCm39) missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23,796,304 (GRCm39) missense possibly damaging 0.94
R5015:Bcl6 UTSW 16 23,793,600 (GRCm39) missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23,791,496 (GRCm39) missense probably benign
R5185:Bcl6 UTSW 16 23,791,697 (GRCm39) missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23,788,736 (GRCm39) missense possibly damaging 0.92
R5586:Bcl6 UTSW 16 23,791,926 (GRCm39) missense probably benign 0.01
R5659:Bcl6 UTSW 16 23,787,159 (GRCm39) nonsense probably null
R5909:Bcl6 UTSW 16 23,791,556 (GRCm39) missense probably benign
R6384:Bcl6 UTSW 16 23,793,615 (GRCm39) missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23,793,611 (GRCm39) missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23,791,364 (GRCm39) missense possibly damaging 0.94
R7122:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7154:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7155:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7156:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7163:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7164:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7434:Bcl6 UTSW 16 23,788,798 (GRCm39) missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23,790,163 (GRCm39) critical splice donor site probably null
R7914:Bcl6 UTSW 16 23,788,761 (GRCm39) missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23,786,883 (GRCm39) missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23,791,698 (GRCm39) missense probably benign 0.39
R8951:Bcl6 UTSW 16 23,793,704 (GRCm39) missense probably damaging 1.00
R8956:Bcl6 UTSW 16 23,793,716 (GRCm39) missense probably damaging 0.99
R9401:Bcl6 UTSW 16 23,791,107 (GRCm39) missense possibly damaging 0.77
R9471:Bcl6 UTSW 16 23,791,857 (GRCm39) missense probably benign 0.32
Z1176:Bcl6 UTSW 16 23,788,708 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATGGCCAGGTCTCCATTCC -3'
(R):5'- ACCTTGTCCCTTGCAATGTG -3'

Sequencing Primer
(F):5'- AGGTCTCCATTCCCCACAGG -3'
(R):5'- CTAGATCAGTGGTTCTCAGCCAG -3'
Posted On 2015-10-08