Incidental Mutation 'R4681:Btnl4'
ID350054
Institutional Source Beutler Lab
Gene Symbol Btnl4
Ensembl Gene ENSMUSG00000058435
Gene Namebutyrophilin-like 4
SynonymsBtnl4, EG632126, NG11
MMRRC Submission 042015-MU
Accession Numbers

Genbank: NM_001039241; MGI: 1932036

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4681 (G1)
Quality Score212
Status Validated
Chromosome17
Chromosomal Location34469042-34475937 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 34470101 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065841]
Predicted Effect probably null
Transcript: ENSMUST00000065841
SMART Domains Protein: ENSMUSP00000064161
Gene: ENSMUSG00000058435

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.44e-7 SMART
Pfam:C2-set_2 150 233 3.6e-6 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
PRY 341 386 7.43e-2 SMART
SPRY 387 510 4.67e-20 SMART
low complexity region 514 554 N/A INTRINSIC
Meta Mutation Damage Score 0.6096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,752,796 T1947K probably benign Het
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Gpr45 A G 1: 43,032,908 D237G probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Nsun7 T A 5: 66,261,199 S91T probably benign Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pifo C A 3: 105,998,385 G148C probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Stk31 A G 6: 49,437,435 D501G probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Unc5c T G 3: 141,768,613 probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Btnl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:Btnl4 APN 17 34475927 missense probably benign 0.34
FR4589:Btnl4 UTSW 17 34472636 missense probably benign 0.30
N/A:Btnl4 UTSW 17 34472586 splice site probably benign
PIT4458001:Btnl4 UTSW 17 34474268 missense probably benign 0.25
R0601:Btnl4 UTSW 17 34469311 missense probably benign 0.07
R0718:Btnl4 UTSW 17 34469634 missense probably benign 0.44
R1163:Btnl4 UTSW 17 34470075 missense possibly damaging 0.65
R1823:Btnl4 UTSW 17 34475852 critical splice donor site probably null
R1954:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R1955:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R4649:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4651:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R6081:Btnl4 UTSW 17 34474236 missense probably damaging 1.00
R6770:Btnl4 UTSW 17 34474037 missense probably benign 0.26
R6859:Btnl4 UTSW 17 34469379 missense probably damaging 1.00
R6885:Btnl4 UTSW 17 34472945 missense probably benign 0.00
R7265:Btnl4 UTSW 17 34475894 missense probably benign 0.00
R7316:Btnl4 UTSW 17 34469057 missense probably benign 0.06
X0023:Btnl4 UTSW 17 34475930 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TATGACTTGCAAGCAGGGG -3'
(R):5'- ACTGGTTCCTGGGAAAGAAGC -3'

Sequencing Primer
(F):5'- CTTGCAAGCAGGGGAAGGTC -3'
(R):5'- ATCCCTTTCCAAAGTTGTGTTTG -3'
Posted On2015-10-08