Incidental Mutation 'R4682:Inpp1'
ID350060
Institutional Source Beutler Lab
Gene Symbol Inpp1
Ensembl Gene ENSMUSG00000026102
Gene Nameinositol polyphosphate-1-phosphatase
Synonyms2300002C06Rik
MMRRC Submission 041934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4682 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52785427-52817688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52794601 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 112 (N112S)
Ref Sequence ENSEMBL: ENSMUSP00000027271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027271] [ENSMUST00000159725] [ENSMUST00000162576] [ENSMUST00000177279]
Predicted Effect probably benign
Transcript: ENSMUST00000027271
AA Change: N112S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027271
Gene: ENSMUSG00000026102
AA Change: N112S

DomainStartEndE-ValueType
Pfam:Inositol_P 56 378 5.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159607
Predicted Effect probably benign
Transcript: ENSMUST00000159725
SMART Domains Protein: ENSMUSP00000123977
Gene: ENSMUSG00000026102

DomainStartEndE-ValueType
PDB:1INP|A 1 80 4e-36 PDB
SCOP:d1inp__ 1 80 8e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162351
Predicted Effect probably benign
Transcript: ENSMUST00000162576
SMART Domains Protein: ENSMUSP00000124890
Gene: ENSMUSG00000026102

DomainStartEndE-ValueType
PDB:1INP|A 1 90 8e-43 PDB
SCOP:d1inp__ 1 90 5e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177279
AA Change: T92A
SMART Domains Protein: ENSMUSP00000135225
Gene: ENSMUSG00000026102
AA Change: T92A

DomainStartEndE-ValueType
PDB:1INP|A 1 68 8e-27 PDB
SCOP:d1inp__ 1 68 1e-31 SMART
low complexity region 71 90 N/A INTRINSIC
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme inositol polyphosphate-1-phosphatase, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 1 of the inositol ring from the polyphosphates inositol 1,4-bisphosphate and inositol 1,3,4-trisphophosphate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a targeted allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Anapc1 A G 2: 128,664,005 V637A probably benign Het
Aurkc G A 7: 6,995,539 V33M probably null Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dapk1 T A 13: 60,751,147 S810R probably benign Het
Dpm2 C T 2: 32,572,278 probably benign Het
Fgb A T 3: 83,043,265 F394Y probably benign Het
Fry A G 5: 150,422,754 Y1576C probably damaging Het
Gabra4 T C 5: 71,657,809 M1V probably null Het
Grhl1 T G 12: 24,608,433 V359G probably benign Het
Hdac5 T C 11: 102,206,630 S158G probably null Het
Hdgfl1 T C 13: 26,769,247 E281G possibly damaging Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Itih1 C A 14: 30,937,843 A279S probably damaging Het
Mad1l1 A T 5: 140,300,252 M296K possibly damaging Het
Mark4 T C 7: 19,445,172 probably null Het
Mrpl48 T A 7: 100,549,369 D192V probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nckap5 A T 1: 126,102,542 probably null Het
Nlrp4d T C 7: 10,374,952 T731A noncoding transcript Het
Olfr1428 T C 19: 12,108,685 Y287C probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Plekhm3 T C 1: 64,937,927 D128G possibly damaging Het
Ppp1r9a A G 6: 4,905,477 T11A possibly damaging Het
Rnf138 T A 18: 21,010,734 Y112N probably damaging Het
Scn9a A T 2: 66,547,018 V442E probably benign Het
Slc36a4 C A 9: 15,726,848 S190* probably null Het
Slc46a1 A G 11: 78,468,676 K378R possibly damaging Het
Snai2 T C 16: 14,708,286 V267A probably benign Het
Srrm2 T A 17: 23,815,692 S533T probably benign Het
St6galnac4 T A 2: 32,594,099 M103K probably damaging Het
Tap2 C A 17: 34,214,032 Y429* probably null Het
Traf7 T C 17: 24,513,374 K159E probably damaging Het
Zfp111 T G 7: 24,199,138 K349N probably damaging Het
Zfp462 A G 4: 55,011,376 Y1114C probably damaging Het
Other mutations in Inpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03343:Inpp1 APN 1 52799327 missense probably damaging 1.00
R0344:Inpp1 UTSW 1 52799354 missense probably damaging 1.00
R1356:Inpp1 UTSW 1 52797056 missense possibly damaging 0.95
R1465:Inpp1 UTSW 1 52790094 missense probably benign
R1465:Inpp1 UTSW 1 52790094 missense probably benign
R1907:Inpp1 UTSW 1 52789670 makesense probably null
R1954:Inpp1 UTSW 1 52794629 missense probably damaging 1.00
R2033:Inpp1 UTSW 1 52790173 missense possibly damaging 0.71
R2104:Inpp1 UTSW 1 52799418 missense probably damaging 1.00
R2224:Inpp1 UTSW 1 52790131 missense probably benign 0.07
R3508:Inpp1 UTSW 1 52799391 missense probably damaging 1.00
R5252:Inpp1 UTSW 1 52794547 missense probably benign 0.00
R5590:Inpp1 UTSW 1 52794661 missense probably damaging 0.96
R6354:Inpp1 UTSW 1 52797065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAAGAAGAACACTATGGGCTAG -3'
(R):5'- TTCAGAACCATTGCTGTGGC -3'

Sequencing Primer
(F):5'- ACACTATGGGCTAGAACGAATG -3'
(R):5'- CTGTGGCACCTAACTGATGAG -3'
Posted On2015-10-08