Incidental Mutation 'R4682:Dapk1'
ID350088
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
MMRRC Submission 041934-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R4682 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60751147 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 810 (S810R)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably benign
Transcript: ENSMUST00000044083
AA Change: S810R

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: S810R

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077453
AA Change: S810R

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: S810R

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225952
Predicted Effect probably benign
Transcript: ENSMUST00000226059
AA Change: S810R

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Anapc1 A G 2: 128,664,005 V637A probably benign Het
Aurkc G A 7: 6,995,539 V33M probably null Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dpm2 C T 2: 32,572,278 probably benign Het
Fgb A T 3: 83,043,265 F394Y probably benign Het
Fry A G 5: 150,422,754 Y1576C probably damaging Het
Gabra4 T C 5: 71,657,809 M1V probably null Het
Grhl1 T G 12: 24,608,433 V359G probably benign Het
Hdac5 T C 11: 102,206,630 S158G probably null Het
Hdgfl1 T C 13: 26,769,247 E281G possibly damaging Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Inpp1 T C 1: 52,794,601 N112S probably benign Het
Itih1 C A 14: 30,937,843 A279S probably damaging Het
Mad1l1 A T 5: 140,300,252 M296K possibly damaging Het
Mark4 T C 7: 19,445,172 probably null Het
Mrpl48 T A 7: 100,549,369 D192V probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nckap5 A T 1: 126,102,542 probably null Het
Nlrp4d T C 7: 10,374,952 T731A noncoding transcript Het
Olfr1428 T C 19: 12,108,685 Y287C probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Plekhm3 T C 1: 64,937,927 D128G possibly damaging Het
Ppp1r9a A G 6: 4,905,477 T11A possibly damaging Het
Rnf138 T A 18: 21,010,734 Y112N probably damaging Het
Scn9a A T 2: 66,547,018 V442E probably benign Het
Slc36a4 C A 9: 15,726,848 S190* probably null Het
Slc46a1 A G 11: 78,468,676 K378R possibly damaging Het
Snai2 T C 16: 14,708,286 V267A probably benign Het
Srrm2 T A 17: 23,815,692 S533T probably benign Het
St6galnac4 T A 2: 32,594,099 M103K probably damaging Het
Tap2 C A 17: 34,214,032 Y429* probably null Het
Traf7 T C 17: 24,513,374 K159E probably damaging Het
Zfp111 T G 7: 24,199,138 K349N probably damaging Het
Zfp462 A G 4: 55,011,376 Y1114C probably damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R1799:Dapk1 UTSW 13 60719654 missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60757353 missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6799:Dapk1 UTSW 13 60752235 missense probably benign
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGATATGAGGAGCACC -3'
(R):5'- CCCAATAGAAGCAGCTCAGG -3'

Sequencing Primer
(F):5'- CCAGATATGGGGAGCATTATATTAAG -3'
(R):5'- ACCTATGGGTTCTTCAACTGGGAC -3'
Posted On2015-10-08