Incidental Mutation 'R4683:Pcsk9'
ID350108
Institutional Source Beutler Lab
Gene Symbol Pcsk9
Ensembl Gene ENSMUSG00000044254
Gene Nameproprotein convertase subtilisin/kexin type 9
SynonymsNarc1
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106442329-106464329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106458895 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 117 (I117N)
Ref Sequence ENSEMBL: ENSMUSP00000055757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049507
AA Change: I117N

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254
AA Change: I117N

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Peptidase_S8 180 438 3.1e-34 PFAM
low complexity region 471 481 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an autocatalytic processing event with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. It is expressed in liver, intestine and kidney tissues and escorts specific receptors for lysosomal degradation. It plays a role in cholesterol and fatty acid metabolism. Mutations in this gene have been associated with autosomal dominant familial hypercholesterolemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice exhibit increased clearance of circulating cholesterol and decreased plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Pcsk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Pcsk9 APN 4 106454646 missense probably benign 0.00
IGL02709:Pcsk9 APN 4 106447689 splice site probably benign
IGL02804:Pcsk9 APN 4 106456964 missense probably damaging 1.00
IGL02850:Pcsk9 APN 4 106458865 missense probably damaging 1.00
IGL03009:Pcsk9 APN 4 106454345 missense probably damaging 1.00
IGL03294:Pcsk9 APN 4 106446770 missense probably benign
R0271:Pcsk9 UTSW 4 106449049 splice site probably benign
R0321:Pcsk9 UTSW 4 106444694 missense probably benign
R0413:Pcsk9 UTSW 4 106454341 missense probably damaging 1.00
R0426:Pcsk9 UTSW 4 106450077 missense possibly damaging 0.77
R0783:Pcsk9 UTSW 4 106450117 missense probably benign 0.00
R2136:Pcsk9 UTSW 4 106446770 missense probably benign 0.00
R4056:Pcsk9 UTSW 4 106444702 missense probably benign 0.02
R4438:Pcsk9 UTSW 4 106458959 missense probably benign 0.00
R4739:Pcsk9 UTSW 4 106447156 missense probably damaging 1.00
R4801:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R4802:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R5249:Pcsk9 UTSW 4 106463753 missense probably benign 0.01
R5307:Pcsk9 UTSW 4 106447174 missense probably damaging 1.00
R5320:Pcsk9 UTSW 4 106463791 missense probably benign 0.00
R5653:Pcsk9 UTSW 4 106458916 missense probably damaging 1.00
R5827:Pcsk9 UTSW 4 106448947 missense probably damaging 1.00
R6010:Pcsk9 UTSW 4 106454272 missense possibly damaging 0.92
R6019:Pcsk9 UTSW 4 106456876 missense probably benign 0.02
R6393:Pcsk9 UTSW 4 106447596 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCAAGTTAAGTAGGCAG -3'
(R):5'- ACTGAGATGAGGTCATGCTG -3'

Sequencing Primer
(F):5'- TAGGCAGTTAGTTATTCAGGGAAC -3'
(R):5'- ATGCTGGGGTCCTCACGTTC -3'
Posted On2015-10-08