Incidental Mutation 'R4683:Gab1'
ID350116
Institutional Source Beutler Lab
Gene Symbol Gab1
Ensembl Gene ENSMUSG00000031714
Gene Namegrowth factor receptor bound protein 2-associated protein 1
Synonyms
MMRRC Submission 041935-MU
Accession Numbers

Genbank: NM_021356; MGI: 108088

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80764438-80880519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80788632 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 352 (H352Q)
Ref Sequence ENSEMBL: ENSMUSP00000034150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034150] [ENSMUST00000210676]
Predicted Effect probably benign
Transcript: ENSMUST00000034150
AA Change: H352Q

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034150
Gene: ENSMUSG00000031714
AA Change: H352Q

DomainStartEndE-ValueType
PH 6 118 1.16e-23 SMART
low complexity region 336 354 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210676
AA Change: H352Q

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211018
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit developmental defects in the placenta, heart, eye, muscle, and skin, and die between embryonic day 13.5 and 18.5. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted, knock-out(1) Targeted, other(8) Gene trapped(34)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Gab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01679:Gab1 APN 8 80791549 missense probably benign 0.00
IGL02610:Gab1 APN 8 80800099 critical splice donor site probably null
IGL02661:Gab1 APN 8 80788937 missense probably damaging 1.00
IGL02716:Gab1 APN 8 80769694 missense probably damaging 1.00
D3080:Gab1 UTSW 8 80766378 missense probably damaging 1.00
R0006:Gab1 UTSW 8 80769730 missense possibly damaging 0.56
R0144:Gab1 UTSW 8 80785201 splice site probably benign
R0173:Gab1 UTSW 8 80800160 missense possibly damaging 0.68
R0414:Gab1 UTSW 8 80800289 missense probably damaging 1.00
R0503:Gab1 UTSW 8 80800142 missense probably damaging 1.00
R0675:Gab1 UTSW 8 80769668 missense probably damaging 1.00
R0690:Gab1 UTSW 8 80800116 missense probably damaging 1.00
R1068:Gab1 UTSW 8 80800172 missense possibly damaging 0.95
R1175:Gab1 UTSW 8 80784842 missense probably damaging 0.99
R1240:Gab1 UTSW 8 80788530 missense probably damaging 1.00
R1430:Gab1 UTSW 8 80788612 missense probably benign 0.34
R1656:Gab1 UTSW 8 80788759 missense probably damaging 1.00
R1986:Gab1 UTSW 8 80766381 missense probably damaging 1.00
R2860:Gab1 UTSW 8 80784753 missense probably benign 0.32
R2861:Gab1 UTSW 8 80784753 missense probably benign 0.32
R4726:Gab1 UTSW 8 80789053 missense possibly damaging 0.80
R5425:Gab1 UTSW 8 80800389 missense probably damaging 1.00
R5684:Gab1 UTSW 8 80769670 missense probably damaging 1.00
R6195:Gab1 UTSW 8 80879532 nonsense probably null
R6217:Gab1 UTSW 8 80791608 missense possibly damaging 0.48
R6233:Gab1 UTSW 8 80879532 nonsense probably null
R6407:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6408:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6415:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6418:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6479:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R7019:Gab1 UTSW 8 80784817 missense probably damaging 0.99
R7291:Gab1 UTSW 8 80800151 missense probably damaging 1.00
R7432:Gab1 UTSW 8 80788669 missense probably benign 0.20
X0066:Gab1 UTSW 8 80879564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTCTTACTCATTAAGCCTTG -3'
(R):5'- CTGCAGGTGTAGAAACGCAG -3'

Sequencing Primer
(F):5'- GCCTTGTGGAAACAGACTTTC -3'
(R):5'- CGCAGATGAGACATGTATCCATCAG -3'
Posted On2015-10-08