Incidental Mutation 'R4683:Ubr5'
ID350130
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 041935-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38037967 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 316 (R316H)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably damaging
Transcript: ENSMUST00000110336
AA Change: R310H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: R310H

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226414
AA Change: R316H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTGATGCCTCTTTTCAACAGTC -3'
(R):5'- CTGCCCACCAAATCATTTAGATACTG -3'

Sequencing Primer
(F):5'- ATGGTTGTTAGGACTCTAATGAAAGG -3'
(R):5'- AGATACTGACTGTGCATTTTGC -3'
Posted On2015-10-08