Incidental Mutation 'R4645:Traf3'
ID350182
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111261966 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 537 (V537A)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021706
AA Change: V537A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: V537A

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060274
AA Change: V512A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: V512A

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117269
AA Change: V512A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: V512A

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143395
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 noncoding transcript Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L584S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 noncoding transcript Het
Immt T C 6: 71,856,939 L227P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 noncoding transcript Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 noncoding transcript Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 noncoding transcript Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 noncoding transcript Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K582R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 noncoding transcript Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2359W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *862C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 noncoding transcript Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
han UTSW 12 111261576 missense
Hulk UTSW 12 111261576 missense probably damaging 1.00
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 nonsense probably null
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense probably benign 0.05
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTACCTGAATGGGGACGGAATG -3'
(R):5'- ACCTCCGTGAAGACACTAGC -3'

Sequencing Primer
(F):5'- CATTATGCGTGGAGAATATGATGCTC -3'
(R):5'- TCCGTGAAGACACTAGCTCACC -3'
Posted OnOct 08, 2015