Incidental Mutation 'R4646:Apob'
ID350273
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 041907-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R4646 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8012759 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 134 (N134S)
Ref Sequence ENSEMBL: ENSMUSP00000129496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]
Predicted Effect probably benign
Transcript: ENSMUST00000037520
AA Change: N3714S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: N3714S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037811
AA Change: N3747S

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: N3747S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171239
AA Change: N134S

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609
AA Change: N134S

DomainStartEndE-ValueType
low complexity region 348 356 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
Acadl A T 1: 66,831,443 S428R probably benign Het
Adamts10 A G 17: 33,545,555 D683G probably damaging Het
Angptl4 G A 17: 33,781,299 P32S probably benign Het
Atr G A 9: 95,871,197 probably null Het
B4galnt1 G A 10: 127,167,836 V223M probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C2cd3 A C 7: 100,372,450 probably benign Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cntrl T C 2: 35,149,461 I557T probably damaging Het
Col26a1 G A 5: 136,847,550 S72F probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Csmd1 T C 8: 15,932,511 I2719V possibly damaging Het
Cul9 C T 17: 46,539,017 W502* probably null Het
Dazl A T 17: 50,288,155 F84I probably damaging Het
Dcaf1 G T 9: 106,846,807 R478L probably benign Het
Dock5 T G 14: 67,842,779 I198L probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dync1li1 T A 9: 114,709,169 V198E probably damaging Het
E130309D02Rik A T 5: 143,307,985 W246R probably damaging Het
Egf A T 3: 129,720,276 C429S probably damaging Het
Ehmt1 T C 2: 24,891,684 E7G probably null Het
Ercc4 G T 16: 13,147,574 R690L probably damaging Het
Erich5 T C 15: 34,470,966 C114R possibly damaging Het
Etv1 T C 12: 38,865,686 S428P possibly damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fbxo31 G T 8: 121,560,016 F174L probably benign Het
Fbxo33 T A 12: 59,204,431 I433L probably benign Het
Fez2 A T 17: 78,412,928 V99E probably damaging Het
Gabarapl2 A C 8: 111,942,553 K48Q probably damaging Het
Gfi1b T A 2: 28,610,137 H294L probably damaging Het
Gk2 A G 5: 97,456,197 S261P probably damaging Het
Gm7534 G A 4: 134,202,148 A282V probably benign Het
Gpr158 T C 2: 21,827,053 I988T probably benign Het
Grk3 G C 5: 112,929,720 H394D probably benign Het
Grm6 A G 11: 50,857,206 E381G probably benign Het
Gtf3c1 A T 7: 125,659,094 M1268K possibly damaging Het
Hikeshi A T 7: 89,923,646 I113N probably damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Kdm5a T G 6: 120,374,977 V176G possibly damaging Het
Kif2a T A 13: 106,962,185 E691V probably damaging Het
Ly6e T C 15: 74,958,661 probably null Het
Map1b G T 13: 99,432,469 P1248Q unknown Het
Mettl25 A G 10: 105,826,555 S185P probably damaging Het
Mfap3l T A 8: 60,671,150 V142D probably damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mkx G A 18: 6,992,040 T280I probably benign Het
Msi1 A T 5: 115,451,455 probably null Het
Muc5b A G 7: 141,862,640 M3108V probably benign Het
Mybl1 A G 1: 9,672,286 S625P probably damaging Het
Myo7b C A 18: 31,994,369 V627F probably benign Het
Ndst3 A T 3: 123,672,035 I96N probably damaging Het
Nrp1 A T 8: 128,457,944 T357S probably benign Het
Obscn G T 11: 59,124,570 Y1050* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1386 A C 11: 49,470,624 I158L probably benign Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr320 A G 11: 58,684,730 N286D probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Olfr74 A T 2: 87,973,798 I289K probably benign Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Pick1 A T 15: 79,248,937 D399V probably benign Het
Pik3c2g T A 6: 139,720,018 S22T probably benign Het
Pnpla2 A G 7: 141,458,661 E276G possibly damaging Het
Pomk A T 8: 25,983,605 S107T probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rimbp3 A G 16: 17,213,098 D1462G probably damaging Het
Rnf112 T A 11: 61,452,110 E230V probably damaging Het
Rock1 T C 18: 10,112,391 T455A probably benign Het
Rtp4 A T 16: 23,610,040 M18L probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Schip1 T C 3: 68,064,964 V8A probably benign Het
Sec31b T C 19: 44,526,621 H351R probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Soga1 T C 2: 157,020,506 E1501G probably damaging Het
Sowahb T C 5: 93,042,856 D668G probably damaging Het
Spam1 A G 6: 24,800,587 T442A probably benign Het
Syt14 T A 1: 192,933,325 Y451F probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Thbs1 G A 2: 118,118,329 A489T probably benign Het
Tnfaip1 C T 11: 78,529,182 R88Q probably damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trim55 T C 3: 19,671,122 F268L probably benign Het
Trmt112 T A 19: 6,910,448 V55E possibly damaging Het
Tube1 A G 10: 39,142,367 M147V possibly damaging Het
Ubn1 A G 16: 5,077,987 T966A probably damaging Het
Unc80 A G 1: 66,669,235 I2651V probably benign Het
Vmn1r172 G A 7: 23,660,494 R268H probably benign Het
Vmn1r231 T A 17: 20,890,309 I115F probably damaging Het
Vmn1r237 A G 17: 21,314,138 K41R probably benign Het
Vmn2r58 A T 7: 41,860,511 N547K probably damaging Het
Vmn2r74 T C 7: 85,957,574 D188G probably benign Het
Vwa5b2 A G 16: 20,596,329 K367R probably damaging Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp11 T A 6: 136,821,191 Y236F probably benign Het
Wbp4 T A 14: 79,472,361 I145F possibly damaging Het
Wwc2 C A 8: 47,920,601 D77Y probably damaging Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 unclassified probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGAGCTTGCAGGAACTCC -3'
(R):5'- TGGCCAACTTATTCAGATCAAAGAC -3'

Sequencing Primer
(F):5'- GGAAAGCGACAGTATCTTCAAGCTTC -3'
(R):5'- TCAAAGACTGTGTTGCCAACTGG -3'
Posted On2015-10-08