Incidental Mutation 'R4647:Slc26a4'
ID350418
Institutional Source Beutler Lab
Gene Symbol Slc26a4
Ensembl Gene ENSMUSG00000020651
Gene Namesolute carrier family 26, member 4
SynonymsPds, pendrin
MMRRC Submission 041908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4647 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31519827-31559969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31540526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 376 (D376A)
Ref Sequence ENSEMBL: ENSMUSP00000001253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001253]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001253
AA Change: D376A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001253
Gene: ENSMUSG00000020651
AA Change: D376A

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
Pfam:Sulfate_transp 84 485 1e-105 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:STAS 536 725 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218992
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are completely deaf with vestibular dysfunction. Mutants show endolymphatic dilatation, degeneration of sensory cells and malformations of otoconia and otoconial membranes. They display unsteady gait and circling and head bobbing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
Aatf T C 11: 84,471,197 D313G possibly damaging Het
Abcb11 T G 2: 69,285,271 D583A probably damaging Het
Adgrv1 A T 13: 81,528,795 Y1252* probably null Het
Aim2 T C 1: 173,455,524 silent Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd27 C T 7: 35,638,234 P991L probably benign Het
Ap1s3 C T 1: 79,614,203 probably null Het
Apbb1 A C 7: 105,565,538 S500A probably benign Het
Arc G A 15: 74,671,525 A283V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C1qtnf4 T A 2: 90,889,652 S90T probably damaging Het
Cachd1 A T 4: 100,953,130 K310* probably null Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Carmil1 G A 13: 24,137,179 L278F probably damaging Het
Ccar1 A T 10: 62,747,417 Y972* probably null Het
Cd163 C T 6: 124,320,621 P909S probably damaging Het
Cd44 T A 2: 102,837,929 H268L possibly damaging Het
Cdkl2 A T 5: 92,017,213 L517Q probably damaging Het
Cep68 G T 11: 20,239,349 N554K probably benign Het
Ces1d A G 8: 93,166,410 W515R probably damaging Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cldn15 T A 5: 136,974,483 I142N probably damaging Het
Cmklr1 T A 5: 113,614,640 D100V probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
D430041D05Rik G A 2: 104,258,443 P63S probably damaging Het
Ddx39 A T 8: 83,722,273 H259L probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dimt1 A T 13: 106,947,655 D50V probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dpp4 G T 2: 62,334,605 T700K probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Eea1 A G 10: 96,028,393 T925A probably benign Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Fam171a1 G A 2: 3,220,291 E140K probably damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fgfr3 C T 5: 33,734,986 probably benign Het
Gabra6 A G 11: 42,307,372 I407T probably damaging Het
Gm13089 T C 4: 143,699,344 M10V probably benign Het
Gm16223 C A 5: 42,214,611 L115M unknown Het
Gm4781 G T 10: 100,397,000 noncoding transcript Het
Gm9772 T A 17: 22,007,032 I70F possibly damaging Het
Gpr107 T A 2: 31,210,501 F497Y probably damaging Het
Grm7 T A 6: 110,914,383 Y192* probably null Het
Gtf2ird2 G A 5: 134,216,192 A431T probably damaging Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
H2-M11 T A 17: 36,547,991 V141D probably benign Het
Hmcn1 A G 1: 150,675,511 probably null Het
Hmcn2 A T 2: 31,399,019 Q2280L possibly damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Igfbp7 T A 5: 77,351,296 Q285L possibly damaging Het
Igkv13-85 T A 6: 68,930,736 probably benign Het
Inpp5e A T 2: 26,407,914 L225H probably benign Het
Inpp5f T A 7: 128,659,109 V91E possibly damaging Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Klra5 T A 6: 129,899,376 D156V probably damaging Het
Kmo C A 1: 175,659,774 Y430* probably null Het
Lbx2 A G 6: 83,088,046 D188G probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lrrc45 T A 11: 120,719,121 S464T probably benign Het
Ltc4s T A 11: 50,237,225 T61S probably benign Het
Luc7l3 A C 11: 94,309,641 N50K probably damaging Het
Ly75 G A 2: 60,308,278 T1415M probably damaging Het
Macf1 T C 4: 123,473,627 E2447G probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mbtd1 C T 11: 93,924,611 H342Y probably damaging Het
Mest C T 6: 30,745,110 R226* probably null Het
Mindy1 A T 3: 95,282,743 probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mn1 A G 5: 111,420,083 T640A probably benign Het
Msi2 T C 11: 88,718,038 H18R possibly damaging Het
Myo18a T A 11: 77,817,950 V61E probably damaging Het
Myo19 T G 11: 84,894,642 I237S probably damaging Het
Ncaph2 T A 15: 89,370,432 L416Q probably damaging Het
Nlrp1a T A 11: 71,097,126 probably null Het
Olfr1450 A G 19: 12,954,077 I163V probably benign Het
Olfr282 G T 15: 98,437,576 V36F probably benign Het
Olfr353 A G 2: 36,890,651 F66L probably benign Het
Olfr559 A G 7: 102,724,092 S133P probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Padi2 T C 4: 140,944,446 F495S probably damaging Het
Pan3 G T 5: 147,527,203 D535Y probably damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl1 T A 19: 11,914,434 D34E probably damaging Het
Pcdha6 A T 18: 36,969,136 T461S probably damaging Het
Pcnt T C 10: 76,354,213 S2830G probably benign Het
Pdgfa G A 5: 138,979,184 T181I probably benign Het
Pds5a C A 5: 65,656,318 D275Y probably damaging Het
Plod2 T A 9: 92,605,450 Y607* probably null Het
Pomt2 G T 12: 87,118,083 T517K possibly damaging Het
Prdm1 T C 10: 44,439,690 T817A probably damaging Het
Prdm2 T C 4: 143,132,955 D1255G possibly damaging Het
Prex2 T A 1: 11,162,285 C859S probably damaging Het
Ralgapa2 A T 2: 146,387,629 M1077K possibly damaging Het
Ralgds T C 2: 28,545,520 probably null Het
Rasa3 T C 8: 13,588,865 E314G probably null Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rnf139 A T 15: 58,899,987 L620F probably benign Het
Rptor T A 11: 119,891,163 N1105K probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Sectm1b A T 11: 121,055,934 V45E probably damaging Het
Selenon A G 4: 134,545,657 W157R probably damaging Het
Sema3b C A 9: 107,599,051 R657L possibly damaging Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Sh3tc1 C T 5: 35,706,318 A842T probably damaging Het
Shank2 A G 7: 144,411,829 E1268G probably damaging Het
Shmt1 G A 11: 60,801,465 S155F probably damaging Het
Sim2 A G 16: 94,123,526 E510G possibly damaging Het
Slc25a46 A T 18: 31,600,192 I168N probably damaging Het
Slfn14 G T 11: 83,276,658 A677E probably benign Het
Slk G T 19: 47,620,274 Q555H possibly damaging Het
Synj1 A T 16: 90,973,989 D517E probably damaging Het
Syvn1 G A 19: 6,051,474 R440Q probably benign Het
Tas2r118 A T 6: 23,969,468 I198N probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Timeless A G 10: 128,239,956 Y19C possibly damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trmt1l G T 1: 151,457,881 V712F possibly damaging Het
Tti1 T C 2: 158,007,020 probably benign Het
Ulk4 T C 9: 121,141,852 H1018R probably benign Het
Vim A T 2: 13,582,495 H461L probably benign Het
Vmn2r118 T A 17: 55,610,665 E282D probably damaging Het
Vmn2r31 T A 7: 7,384,368 I735F probably damaging Het
Vmn2r88 A G 14: 51,418,793 M829V probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp2 T A 11: 116,082,381 M67L probably benign Het
Wdr81 T A 11: 75,445,988 E1525V probably damaging Het
Xbp1 A G 11: 5,522,006 D44G probably damaging Het
Zfhx4 T G 3: 5,399,281 F1500V probably damaging Het
Zfp286 A C 11: 62,783,733 Y95* probably null Het
Zfp872 A G 9: 22,199,761 T178A possibly damaging Het
Zkscan5 A G 5: 145,218,830 H364R possibly damaging Het
Zp3r A T 1: 130,577,960 Y422N probably damaging Het
Zscan10 C T 17: 23,610,340 R542C probably benign Het
Other mutations in Slc26a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Slc26a4 APN 12 31528854 splice site probably benign
IGL01763:Slc26a4 APN 12 31528854 splice site probably benign
IGL01778:Slc26a4 APN 12 31528854 splice site probably benign
IGL01779:Slc26a4 APN 12 31528854 splice site probably benign
IGL01872:Slc26a4 APN 12 31539203 missense probably benign 0.22
IGL02016:Slc26a4 APN 12 31535667 missense probably damaging 0.99
IGL02184:Slc26a4 APN 12 31549949 missense probably damaging 1.00
IGL02267:Slc26a4 APN 12 31528854 splice site probably benign
IGL02270:Slc26a4 APN 12 31528854 splice site probably benign
IGL02271:Slc26a4 APN 12 31528854 splice site probably benign
IGL02347:Slc26a4 APN 12 31528854 splice site probably benign
IGL02543:Slc26a4 APN 12 31528689 missense possibly damaging 0.75
IGL02803:Slc26a4 APN 12 31522527 critical splice acceptor site probably null
IGL02885:Slc26a4 APN 12 31525476 missense probably benign 0.00
IGL02974:Slc26a4 APN 12 31529554 missense probably damaging 1.00
IGL03037:Slc26a4 APN 12 31531687 splice site probably benign
cul-de-sac UTSW 12 31525568 nonsense probably null
discobolus UTSW 12 31540533 nonsense probably null
R0152:Slc26a4 UTSW 12 31529498 missense probably damaging 1.00
R0677:Slc26a4 UTSW 12 31549911 critical splice donor site probably null
R0961:Slc26a4 UTSW 12 31535619 missense probably benign
R1025:Slc26a4 UTSW 12 31528737 missense probably damaging 1.00
R1301:Slc26a4 UTSW 12 31525568 nonsense probably null
R1729:Slc26a4 UTSW 12 31544494 missense possibly damaging 0.95
R2321:Slc26a4 UTSW 12 31540544 missense probably damaging 1.00
R3967:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R3970:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R4007:Slc26a4 UTSW 12 31540533 nonsense probably null
R4370:Slc26a4 UTSW 12 31529476 missense probably benign 0.01
R4648:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R5816:Slc26a4 UTSW 12 31528685 missense probably damaging 1.00
R5932:Slc26a4 UTSW 12 31535249 critical splice donor site probably null
R6675:Slc26a4 UTSW 12 31540513 missense possibly damaging 0.89
R6732:Slc26a4 UTSW 12 31526600 critical splice donor site probably null
R6890:Slc26a4 UTSW 12 31549951 missense possibly damaging 0.79
R7231:Slc26a4 UTSW 12 31547946 missense probably damaging 1.00
R7286:Slc26a4 UTSW 12 31529528 nonsense probably null
X0022:Slc26a4 UTSW 12 31535687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACTTGGTATGCATATTTCAAA -3'
(R):5'- TACCACGTCACTGAGTGAAGAG -3'

Sequencing Primer
(F):5'- TCCTTAGGTGAACCCCAAG -3'
(R):5'- CACTGAGTGAAGAGAGTGTTTGGC -3'
Posted On2015-10-08