Incidental Mutation 'R0268:Olfr998'
ID35042
Institutional Source Beutler Lab
Gene Symbol Olfr998
Ensembl Gene ENSMUSG00000111454
Gene Nameolfactory receptor 998
SynonymsGA_x6K02T2Q125-47069356-47070300, MOR175-5
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R0268 (G1)
Quality Score187
Status Validated
Chromosome2
Chromosomal Location85588948-85591893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85591301 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 254 (T254A)
Ref Sequence ENSEMBL: ENSMUSP00000150713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052307] [ENSMUST00000215083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052307
AA Change: T254A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059970
Gene: ENSMUSG00000111454
AA Change: T254A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-54 PFAM
Pfam:7tm_1 41 308 9.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215083
AA Change: T254A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gls GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG 1: 52,232,694 probably benign Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Olfr998
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Olfr998 APN 2 85591347 missense probably benign 0.00
R0091:Olfr998 UTSW 2 85591352 missense probably benign 0.38
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0481:Olfr998 UTSW 2 85591104 missense possibly damaging 0.94
R1816:Olfr998 UTSW 2 85590925 missense probably benign 0.00
R1988:Olfr998 UTSW 2 85590641 missense probably benign 0.00
R2008:Olfr998 UTSW 2 85591422 missense probably damaging 1.00
R2060:Olfr998 UTSW 2 85591283 missense possibly damaging 0.78
R2273:Olfr998 UTSW 2 85590588 missense probably damaging 1.00
R4409:Olfr998 UTSW 2 85590930 missense probably damaging 1.00
R4783:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R4785:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R5098:Olfr998 UTSW 2 85590632 missense probably benign 0.00
R5176:Olfr998 UTSW 2 85591435 missense possibly damaging 0.88
R5462:Olfr998 UTSW 2 85591296 missense probably damaging 1.00
R6092:Olfr998 UTSW 2 85590606 missense probably benign 0.14
R6278:Olfr998 UTSW 2 85590998 missense probably benign 0.00
R7022:Olfr998 UTSW 2 85590598 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATCTGGTTGTAGGGCCATATGTC -3'
(R):5'- ACCTCACCTGCCTGCTGGAAAATG -3'

Sequencing Primer
(F):5'- ACCGTTCTGTGGTTCAAATACC -3'
(R):5'- GCTGGAAAATGTTTCTTTTGCACC -3'
Posted On2013-05-09