Incidental Mutation 'R4648:Olfr152'
ID350461
Institutional Source Beutler Lab
Gene Symbol Olfr152
Ensembl Gene ENSMUSG00000068816
Gene Nameolfactory receptor 152
SynonymsV1, MOR181-1, GA_x6K02T2Q125-49283184-49284128, Olfr4-1
MMRRC Submission 041909-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R4648 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87779483-87784572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87783221 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000150778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090709] [ENSMUST00000105210] [ENSMUST00000215394]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090709
AA Change: V229A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088211
Gene: ENSMUSG00000068816
AA Change: V229A

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 4.3e-49 PFAM
Pfam:7tm_1 45 314 7.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105210
AA Change: V227A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100845
Gene: ENSMUSG00000068816
AA Change: V227A

DomainStartEndE-ValueType
Pfam:7tm_1 43 292 6.4e-28 PFAM
Pfam:7tm_4 141 285 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213624
Predicted Effect possibly damaging
Transcript: ENSMUST00000215394
AA Change: V227A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
2310079G19Rik T C 16: 88,627,367 S79G probably benign Het
4930568D16Rik T A 2: 35,354,446 Y298F probably damaging Het
Alpk2 A G 18: 65,349,882 F352L probably damaging Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd33b T C 15: 31,325,024 *129W probably null Het
Atp5j T C 16: 84,828,455 M87V probably benign Het
Atp8b3 A G 10: 80,525,623 S822P possibly damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bbs2 A T 8: 94,080,879 V429E probably damaging Het
Bccip C T 7: 133,714,899 L83F probably damaging Het
Brd9 G A 13: 73,940,776 V198I probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C77080 G T 4: 129,221,940 T977K probably benign Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Ccdc110 A T 8: 45,942,668 Q532L possibly damaging Het
Cdh19 G A 1: 110,925,177 L343F probably benign Het
Cep350 A G 1: 155,902,598 S1653P possibly damaging Het
Cmtm4 A G 8: 104,356,320 I135T possibly damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Crp A G 1: 172,698,137 M1V probably null Het
Csmd1 G A 8: 15,998,788 Q2305* probably null Het
Cyp2c38 T A 19: 39,460,688 I74F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcaf1 A T 9: 106,865,677 probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dock7 C A 4: 98,969,644 E1448* probably null Het
Dpf2 C T 19: 5,907,081 R38H probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Etnk1 A G 6: 143,195,274 Y248C probably damaging Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Gk2 T C 5: 97,455,720 S420G probably benign Het
Gm26596 T C 10: 112,929,159 probably benign Het
Gm5414 G T 15: 101,628,108 N27K possibly damaging Het
Gskip A G 12: 105,698,729 D9G probably benign Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
Hk1 T G 10: 62,304,779 S105R probably benign Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Idnk A G 13: 58,162,869 D67G probably benign Het
Igfbp5 G T 1: 72,864,063 H118N probably benign Het
Irf4 A T 13: 30,763,597 Y427F probably benign Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Kif7 T C 7: 79,709,191 D512G probably damaging Het
Lamb3 T A 1: 193,331,357 I513N probably damaging Het
Lipo1 A G 19: 33,783,460 L174P probably damaging Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mast2 G T 4: 116,314,839 Y637* probably null Het
Matn2 T C 15: 34,428,533 I681T probably damaging Het
Med18 A T 4: 132,462,963 V37D possibly damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mpg C A 11: 32,230,034 C187* probably null Het
Mtmr14 A G 6: 113,260,606 E256G probably benign Het
Myo7b C T 18: 31,967,125 probably null Het
Nmt1 T A 11: 103,063,917 V425D probably damaging Het
Nynrin T A 14: 55,872,894 Y1819* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1330 A G 4: 118,893,950 N289S possibly damaging Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Phc1 T C 6: 122,321,913 I699V possibly damaging Het
Prkdc T G 16: 15,816,774 D3594E probably benign Het
Pstpip1 A T 9: 56,125,218 D246V probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Ror2 A T 13: 53,285,500 C9* probably null Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Smarcad1 A G 6: 65,067,089 E215G probably benign Het
Spag16 G A 1: 69,827,035 R11Q probably null Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tbc1d5 A G 17: 50,736,223 C746R probably benign Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trem1 G A 17: 48,244,562 V84I probably benign Het
Tspan5 T C 3: 138,898,315 F154L probably damaging Het
Usp45 A G 4: 21,825,044 R647G probably benign Het
Usp50 T A 2: 126,778,033 I120F probably damaging Het
Vil1 T C 1: 74,432,298 M746T probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Olfr152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr152 APN 2 87782539 missense probably benign
IGL01124:Olfr152 APN 2 87783376 missense probably benign 0.01
IGL01383:Olfr152 APN 2 87782873 missense possibly damaging 0.92
IGL01501:Olfr152 APN 2 87783136 missense possibly damaging 0.85
IGL02279:Olfr152 APN 2 87783232 missense probably damaging 0.99
R0141:Olfr152 UTSW 2 87782705 missense possibly damaging 0.74
R0212:Olfr152 UTSW 2 87783482 missense unknown
R0492:Olfr152 UTSW 2 87782822 missense probably damaging 1.00
R1611:Olfr152 UTSW 2 87782624 missense probably benign 0.38
R1697:Olfr152 UTSW 2 87782585 missense possibly damaging 0.95
R3606:Olfr152 UTSW 2 87783207 missense probably benign 0.26
R4583:Olfr152 UTSW 2 87783221 missense possibly damaging 0.76
R4646:Olfr152 UTSW 2 87783221 missense possibly damaging 0.76
R4853:Olfr152 UTSW 2 87783182 missense probably benign 0.04
R6102:Olfr152 UTSW 2 87782848 missense probably damaging 1.00
R6154:Olfr152 UTSW 2 87782756 missense possibly damaging 0.94
Z1088:Olfr152 UTSW 2 87782628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAGTTCTTTGGTTCACACATC -3'
(R):5'- CAATGGGTTTAGCACTGGGATG -3'

Sequencing Primer
(F):5'- GAGTTCTTTGGTTCACACATCTTTTG -3'
(R):5'- TTAGCACTGGGATGATAATAGTGTAG -3'
Posted On2015-10-08