Incidental Mutation 'R0268:Casp8ap2'
ID35051
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0268 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32644079 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1051 (I1051F)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably damaging
Transcript: ENSMUST00000029950
AA Change: I1051F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: I1051F

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect probably damaging
Transcript: ENSMUST00000178925
AA Change: I1051F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: I1051F

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gls GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG 1: 52,232,694 probably benign Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32643974 missense possibly damaging 0.84
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGACTGCTGTAAAACTCCCTCGG -3'
(R):5'- AACGGTCAACTATGCCATTCTTCTTCA -3'

Sequencing Primer
(F):5'- TGTAAAACTCCCTCGGGACAG -3'
(R):5'- GCCATTCTTCTTCACTTGTTTAAGG -3'
Posted On2013-05-09