Incidental Mutation 'R4648:Slc26a4'
ID350513
Institutional Source Beutler Lab
Gene Symbol Slc26a4
Ensembl Gene ENSMUSG00000020651
Gene Namesolute carrier family 26, member 4
SynonymsPds, pendrin
MMRRC Submission 041909-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4648 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31519827-31559969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31540526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 376 (D376A)
Ref Sequence ENSEMBL: ENSMUSP00000001253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001253]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001253
AA Change: D376A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001253
Gene: ENSMUSG00000020651
AA Change: D376A

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
Pfam:Sulfate_transp 84 485 1e-105 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:STAS 536 725 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218992
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are completely deaf with vestibular dysfunction. Mutants show endolymphatic dilatation, degeneration of sensory cells and malformations of otoconia and otoconial membranes. They display unsteady gait and circling and head bobbing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
2310079G19Rik T C 16: 88,627,367 S79G probably benign Het
4930568D16Rik T A 2: 35,354,446 Y298F probably damaging Het
Alpk2 A G 18: 65,349,882 F352L probably damaging Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd33b T C 15: 31,325,024 *129W probably null Het
Atp5j T C 16: 84,828,455 M87V probably benign Het
Atp8b3 A G 10: 80,525,623 S822P possibly damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bbs2 A T 8: 94,080,879 V429E probably damaging Het
Bccip C T 7: 133,714,899 L83F probably damaging Het
Brd9 G A 13: 73,940,776 V198I probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C77080 G T 4: 129,221,940 T977K probably benign Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Ccdc110 A T 8: 45,942,668 Q532L possibly damaging Het
Cdh19 G A 1: 110,925,177 L343F probably benign Het
Cep350 A G 1: 155,902,598 S1653P possibly damaging Het
Cmtm4 A G 8: 104,356,320 I135T possibly damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Crp A G 1: 172,698,137 M1V probably null Het
Csmd1 G A 8: 15,998,788 Q2305* probably null Het
Cyp2c38 T A 19: 39,460,688 I74F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcaf1 A T 9: 106,865,677 probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dock7 C A 4: 98,969,644 E1448* probably null Het
Dpf2 C T 19: 5,907,081 R38H probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Etnk1 A G 6: 143,195,274 Y248C probably damaging Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Gk2 T C 5: 97,455,720 S420G probably benign Het
Gm26596 T C 10: 112,929,159 probably benign Het
Gm5414 G T 15: 101,628,108 N27K possibly damaging Het
Gskip A G 12: 105,698,729 D9G probably benign Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
Hk1 T G 10: 62,304,779 S105R probably benign Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Idnk A G 13: 58,162,869 D67G probably benign Het
Igfbp5 G T 1: 72,864,063 H118N probably benign Het
Irf4 A T 13: 30,763,597 Y427F probably benign Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Kif7 T C 7: 79,709,191 D512G probably damaging Het
Lamb3 T A 1: 193,331,357 I513N probably damaging Het
Lipo1 A G 19: 33,783,460 L174P probably damaging Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mast2 G T 4: 116,314,839 Y637* probably null Het
Matn2 T C 15: 34,428,533 I681T probably damaging Het
Med18 A T 4: 132,462,963 V37D possibly damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mpg C A 11: 32,230,034 C187* probably null Het
Mtmr14 A G 6: 113,260,606 E256G probably benign Het
Myo7b C T 18: 31,967,125 probably null Het
Nmt1 T A 11: 103,063,917 V425D probably damaging Het
Nynrin T A 14: 55,872,894 Y1819* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1330 A G 4: 118,893,950 N289S possibly damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Phc1 T C 6: 122,321,913 I699V possibly damaging Het
Prkdc T G 16: 15,816,774 D3594E probably benign Het
Pstpip1 A T 9: 56,125,218 D246V probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Ror2 A T 13: 53,285,500 C9* probably null Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Smarcad1 A G 6: 65,067,089 E215G probably benign Het
Spag16 G A 1: 69,827,035 R11Q probably null Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tbc1d5 A G 17: 50,736,223 C746R probably benign Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trem1 G A 17: 48,244,562 V84I probably benign Het
Tspan5 T C 3: 138,898,315 F154L probably damaging Het
Usp45 A G 4: 21,825,044 R647G probably benign Het
Usp50 T A 2: 126,778,033 I120F probably damaging Het
Vil1 T C 1: 74,432,298 M746T probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Slc26a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Slc26a4 APN 12 31528854 splice site probably benign
IGL01763:Slc26a4 APN 12 31528854 splice site probably benign
IGL01778:Slc26a4 APN 12 31528854 splice site probably benign
IGL01779:Slc26a4 APN 12 31528854 splice site probably benign
IGL01872:Slc26a4 APN 12 31539203 missense probably benign 0.22
IGL02016:Slc26a4 APN 12 31535667 missense probably damaging 0.99
IGL02184:Slc26a4 APN 12 31549949 missense probably damaging 1.00
IGL02267:Slc26a4 APN 12 31528854 splice site probably benign
IGL02270:Slc26a4 APN 12 31528854 splice site probably benign
IGL02271:Slc26a4 APN 12 31528854 splice site probably benign
IGL02347:Slc26a4 APN 12 31528854 splice site probably benign
IGL02543:Slc26a4 APN 12 31528689 missense possibly damaging 0.75
IGL02803:Slc26a4 APN 12 31522527 critical splice acceptor site probably null
IGL02885:Slc26a4 APN 12 31525476 missense probably benign 0.00
IGL02974:Slc26a4 APN 12 31529554 missense probably damaging 1.00
IGL03037:Slc26a4 APN 12 31531687 splice site probably benign
cul-de-sac UTSW 12 31525568 nonsense probably null
discobolus UTSW 12 31540533 nonsense probably null
R0152:Slc26a4 UTSW 12 31529498 missense probably damaging 1.00
R0677:Slc26a4 UTSW 12 31549911 critical splice donor site probably null
R0961:Slc26a4 UTSW 12 31535619 missense probably benign
R1025:Slc26a4 UTSW 12 31528737 missense probably damaging 1.00
R1301:Slc26a4 UTSW 12 31525568 nonsense probably null
R1729:Slc26a4 UTSW 12 31544494 missense possibly damaging 0.95
R2321:Slc26a4 UTSW 12 31540544 missense probably damaging 1.00
R3967:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R3970:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R4007:Slc26a4 UTSW 12 31540533 nonsense probably null
R4370:Slc26a4 UTSW 12 31529476 missense probably benign 0.01
R4647:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R5816:Slc26a4 UTSW 12 31528685 missense probably damaging 1.00
R5932:Slc26a4 UTSW 12 31535249 critical splice donor site probably null
R6675:Slc26a4 UTSW 12 31540513 missense possibly damaging 0.89
R6732:Slc26a4 UTSW 12 31526600 critical splice donor site probably null
R6890:Slc26a4 UTSW 12 31549951 missense possibly damaging 0.79
X0022:Slc26a4 UTSW 12 31535687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACTTGGTATGCATATTTCAAA -3'
(R):5'- TACCACGTCACTGAGTGAAGAG -3'

Sequencing Primer
(F):5'- TCCTTAGGTGAACCCCAAG -3'
(R):5'- CACTGAGTGAAGAGAGTGTTTGGC -3'
Posted On2015-10-08