Incidental Mutation 'R4648:Tdh'
ID350521
Institutional Source Beutler Lab
Gene Symbol Tdh
Ensembl Gene ENSMUSG00000021953
Gene NameL-threonine dehydrogenase
Synonyms
MMRRC Submission 041909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4648 (G1)
Quality Score195
Status Not validated
Chromosome14
Chromosomal Location63492347-63509092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63493756 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 323 (L323P)
Ref Sequence ENSEMBL: ENSMUSP00000022522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022522] [ENSMUST00000165776] [ENSMUST00000168488] [ENSMUST00000168669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022522
AA Change: L323P

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022522
Gene: ENSMUSG00000021953
AA Change: L323P

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 56 252 3.3e-10 PFAM
Pfam:Epimerase 58 294 5.8e-22 PFAM
Pfam:3Beta_HSD 59 185 7e-9 PFAM
Pfam:GDP_Man_Dehyd 59 359 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164515
Predicted Effect probably benign
Transcript: ENSMUST00000165776
SMART Domains Protein: ENSMUSP00000129206
Gene: ENSMUSG00000021953

DomainStartEndE-ValueType
SCOP:d1kc0a_ 42 149 3e-11 SMART
PDB:3A4V|B 43 144 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168488
SMART Domains Protein: ENSMUSP00000131068
Gene: ENSMUSG00000021953

DomainStartEndE-ValueType
SCOP:d1kc0a_ 42 140 5e-11 SMART
PDB:3A4V|B 43 148 1e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168669
SMART Domains Protein: ENSMUSP00000132119
Gene: ENSMUSG00000021953

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 41 205 6.9e-10 PFAM
Pfam:Polysacc_synt_2 43 164 2.2e-6 PFAM
Pfam:Epimerase 43 200 9.2e-13 PFAM
Pfam:3Beta_HSD 44 168 5.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170772
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
2310079G19Rik T C 16: 88,627,367 S79G probably benign Het
4930568D16Rik T A 2: 35,354,446 Y298F probably damaging Het
Alpk2 A G 18: 65,349,882 F352L probably damaging Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd33b T C 15: 31,325,024 *129W probably null Het
Atp5j T C 16: 84,828,455 M87V probably benign Het
Atp8b3 A G 10: 80,525,623 S822P possibly damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bbs2 A T 8: 94,080,879 V429E probably damaging Het
Bccip C T 7: 133,714,899 L83F probably damaging Het
Brd9 G A 13: 73,940,776 V198I probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C77080 G T 4: 129,221,940 T977K probably benign Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Ccdc110 A T 8: 45,942,668 Q532L possibly damaging Het
Cdh19 G A 1: 110,925,177 L343F probably benign Het
Cep350 A G 1: 155,902,598 S1653P possibly damaging Het
Cmtm4 A G 8: 104,356,320 I135T possibly damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Crp A G 1: 172,698,137 M1V probably null Het
Csmd1 G A 8: 15,998,788 Q2305* probably null Het
Cyp2c38 T A 19: 39,460,688 I74F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcaf1 A T 9: 106,865,677 probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dock7 C A 4: 98,969,644 E1448* probably null Het
Dpf2 C T 19: 5,907,081 R38H probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Etnk1 A G 6: 143,195,274 Y248C probably damaging Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Gk2 T C 5: 97,455,720 S420G probably benign Het
Gm26596 T C 10: 112,929,159 probably benign Het
Gm5414 G T 15: 101,628,108 N27K possibly damaging Het
Gskip A G 12: 105,698,729 D9G probably benign Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
Hk1 T G 10: 62,304,779 S105R probably benign Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Idnk A G 13: 58,162,869 D67G probably benign Het
Igfbp5 G T 1: 72,864,063 H118N probably benign Het
Irf4 A T 13: 30,763,597 Y427F probably benign Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Kif7 T C 7: 79,709,191 D512G probably damaging Het
Lamb3 T A 1: 193,331,357 I513N probably damaging Het
Lipo1 A G 19: 33,783,460 L174P probably damaging Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mast2 G T 4: 116,314,839 Y637* probably null Het
Matn2 T C 15: 34,428,533 I681T probably damaging Het
Med18 A T 4: 132,462,963 V37D possibly damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mpg C A 11: 32,230,034 C187* probably null Het
Mtmr14 A G 6: 113,260,606 E256G probably benign Het
Myo7b C T 18: 31,967,125 probably null Het
Nmt1 T A 11: 103,063,917 V425D probably damaging Het
Nynrin T A 14: 55,872,894 Y1819* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1330 A G 4: 118,893,950 N289S possibly damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Phc1 T C 6: 122,321,913 I699V possibly damaging Het
Prkdc T G 16: 15,816,774 D3594E probably benign Het
Pstpip1 A T 9: 56,125,218 D246V probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Ror2 A T 13: 53,285,500 C9* probably null Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Smarcad1 A G 6: 65,067,089 E215G probably benign Het
Spag16 G A 1: 69,827,035 R11Q probably null Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tbc1d5 A G 17: 50,736,223 C746R probably benign Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trem1 G A 17: 48,244,562 V84I probably benign Het
Tspan5 T C 3: 138,898,315 F154L probably damaging Het
Usp45 A G 4: 21,825,044 R647G probably benign Het
Usp50 T A 2: 126,778,033 I120F probably damaging Het
Vil1 T C 1: 74,432,298 M746T probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Tdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Tdh APN 14 63495764 missense probably damaging 1.00
IGL02047:Tdh APN 14 63496958 missense probably benign 0.07
R0126:Tdh UTSW 14 63497593 splice site probably benign
R1530:Tdh UTSW 14 63496055 missense probably damaging 1.00
R3748:Tdh UTSW 14 63495993 missense probably benign 0.26
R4589:Tdh UTSW 14 63495877 missense probably damaging 1.00
R4646:Tdh UTSW 14 63493756 missense possibly damaging 0.51
R4647:Tdh UTSW 14 63493756 missense possibly damaging 0.51
R5038:Tdh UTSW 14 63496126 nonsense probably null
R5275:Tdh UTSW 14 63496109 missense probably damaging 1.00
R5295:Tdh UTSW 14 63496109 missense probably damaging 1.00
R6319:Tdh UTSW 14 63495737 missense probably benign 0.00
R6825:Tdh UTSW 14 63495832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAAATGGGTCGGACTCTC -3'
(R):5'- GCAAAGAACGGCACATTCG -3'

Sequencing Primer
(F):5'- AAATGGGTCGGACTCTCTCCTG -3'
(R):5'- ATTCGAGTGCAACCTCGAG -3'
Posted On2015-10-08